Incidental Mutation 'R8165:Tll2'
ID633751
Institutional Source Beutler Lab
Gene Symbol Tll2
Ensembl Gene ENSMUSG00000025013
Gene Nametolloid-like 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.846) question?
Stock #R8165 (G1)
Quality Score213.009
Status Validated
Chromosome19
Chromosomal Location41083981-41206774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41088874 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 818 (F818L)
Ref Sequence ENSEMBL: ENSMUSP00000025986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025986] [ENSMUST00000169941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025986
AA Change: F818L

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025986
Gene: ENSMUSG00000025013
AA Change: F818L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
ZnMc 152 294 1.15e-54 SMART
CUB 348 460 7.69e-44 SMART
CUB 461 573 8.69e-52 SMART
EGF_CA 573 614 1.26e-11 SMART
CUB 617 729 3.99e-51 SMART
EGF_CA 729 769 5.92e-8 SMART
CUB 773 885 3.08e-43 SMART
CUB 886 1002 2.25e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169941
AA Change: F801L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125973
Gene: ENSMUSG00000025013
AA Change: F801L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
ZnMc 152 294 1.15e-54 SMART
CUB 331 443 7.69e-44 SMART
CUB 444 556 8.69e-52 SMART
EGF_CA 556 597 1.26e-11 SMART
CUB 600 712 3.99e-51 SMART
EGF_CA 712 752 5.92e-8 SMART
CUB 756 868 3.08e-43 SMART
CUB 869 985 2.25e-36 SMART
Meta Mutation Damage Score 0.2942 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased muscle weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,897,946 probably null Het
1110037F02Rik T A 4: 11,542,128 D1521E probably benign Het
Amph A G 13: 19,094,837 K161E probably benign Het
Aox2 A T 1: 58,308,929 H602L probably benign Het
Areg A G 5: 91,143,633 N145S probably damaging Het
Arhgap29 C T 3: 121,988,573 T142I probably damaging Het
Bcar3 C T 3: 122,511,156 probably benign Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Btnl2 T A 17: 34,368,708 S509T possibly damaging Het
Cacna2d2 A G 9: 107,525,454 probably null Het
Casz1 C T 4: 148,944,431 P1111L probably damaging Het
Ccdc91 C T 6: 147,631,588 T411I unknown Het
Chd9 A C 8: 91,041,141 E2422A probably damaging Het
Clrn3 T C 7: 135,528,404 I34V probably benign Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Cops8 A G 1: 90,612,007 probably null Het
Cpa2 A G 6: 30,564,346 K392R probably benign Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Dnase1l3 T C 14: 7,994,299 probably benign Het
Fam65a C A 8: 105,620,888 L1028M unknown Het
Gdpd5 A T 7: 99,456,482 T502S probably benign Het
Gp2 A T 7: 119,450,152 D387E probably damaging Het
Gpr179 A G 11: 97,351,538 L160P probably benign Het
Hmcn1 G A 1: 150,646,658 T3497M probably benign Het
Idh3b T A 2: 130,280,500 T322S possibly damaging Het
Kit A T 5: 75,620,880 N323I possibly damaging Het
Kng2 T C 16: 22,987,496 S445G unknown Het
Lin54 A G 5: 100,454,499 V393A probably benign Het
Lyst T A 13: 13,698,360 W2715R probably damaging Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Med7 T A 11: 46,441,246 C223S probably benign Het
Megf8 T A 7: 25,353,873 L1823Q probably damaging Het
Mga C A 2: 119,947,238 Q1755K probably benign Het
Mgat4b A T 11: 50,210,974 N22I probably benign Het
Ndufb6 C T 4: 40,270,665 probably null Het
Neil3 A G 8: 53,589,094 L490P probably benign Het
Nek9 C T 12: 85,303,643 V886I probably benign Het
Nol4l A T 2: 153,420,553 Y366* probably null Het
Nt5dc2 A G 14: 31,138,929 T354A probably damaging Het
Olfr339 T A 2: 36,421,703 Y102N probably damaging Het
Pde2a G A 7: 101,500,448 probably null Het
Phf1 T C 17: 26,937,070 F444L possibly damaging Het
Plin4 G A 17: 56,107,019 T202I possibly damaging Het
Plk4 G C 3: 40,813,574 V851L probably damaging Het
Pp2d1 A G 17: 53,515,229 S270P probably damaging Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Sel1l2 T A 2: 140,262,706 L306F probably damaging Het
Spic A T 10: 88,677,566 S86T probably damaging Het
Stkld1 A G 2: 26,946,656 N278S probably benign Het
Taar7d T A 10: 24,027,597 F126I probably benign Het
Tbc1d31 A G 15: 57,960,949 E869G possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Terf2 T C 8: 107,083,024 K221E possibly damaging Het
Tex43 T A 18: 56,589,475 probably benign Het
Thsd7a T A 6: 12,468,963 T539S Het
Tmem87a T C 2: 120,370,478 T427A possibly damaging Het
Ush2a C A 1: 188,451,755 Q1419K possibly damaging Het
Vill T A 9: 119,066,753 F511Y probably damaging Het
Vps13c A G 9: 67,858,790 D63G probably benign Het
Vrk2 A G 11: 26,535,575 F138L probably benign Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zgrf1 T A 3: 127,563,383 F753I possibly damaging Het
Other mutations in Tll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Tll2 APN 19 41086366 missense probably benign 0.01
IGL02028:Tll2 APN 19 41098649 nonsense probably null
IGL02146:Tll2 APN 19 41097837 missense probably benign 0.00
IGL02192:Tll2 APN 19 41086263 missense possibly damaging 0.73
IGL02544:Tll2 APN 19 41135965 missense probably damaging 1.00
PIT4677001:Tll2 UTSW 19 41130558 missense probably benign 0.14
R0141:Tll2 UTSW 19 41097912 missense probably damaging 1.00
R0372:Tll2 UTSW 19 41183313 critical splice acceptor site probably null
R0393:Tll2 UTSW 19 41088826 missense possibly damaging 0.95
R0402:Tll2 UTSW 19 41098693 missense possibly damaging 0.56
R0613:Tll2 UTSW 19 41104990 missense probably damaging 0.97
R0756:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R0757:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R0790:Tll2 UTSW 19 41103850 missense probably damaging 0.98
R0834:Tll2 UTSW 19 41113073 missense probably damaging 1.00
R0843:Tll2 UTSW 19 41128463 splice site probably null
R1014:Tll2 UTSW 19 41103851 missense probably damaging 1.00
R1178:Tll2 UTSW 19 41092847 missense probably damaging 1.00
R1233:Tll2 UTSW 19 41095984 missense possibly damaging 0.79
R1364:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1367:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1368:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1519:Tll2 UTSW 19 41086400 missense probably benign 0.17
R1894:Tll2 UTSW 19 41088671 critical splice donor site probably null
R1896:Tll2 UTSW 19 41113059 missense probably benign 0.44
R1917:Tll2 UTSW 19 41128497 missense possibly damaging 0.83
R2170:Tll2 UTSW 19 41183275 missense probably damaging 1.00
R4433:Tll2 UTSW 19 41121348 missense probably benign 0.03
R4617:Tll2 UTSW 19 41098636 missense probably benign 0.31
R4831:Tll2 UTSW 19 41130512 missense probably damaging 1.00
R5057:Tll2 UTSW 19 41117266 missense probably benign 0.02
R5119:Tll2 UTSW 19 41130509 missense possibly damaging 0.48
R5194:Tll2 UTSW 19 41095897 missense probably damaging 1.00
R5280:Tll2 UTSW 19 41117257 missense possibly damaging 0.87
R5602:Tll2 UTSW 19 41104981 missense possibly damaging 0.63
R5800:Tll2 UTSW 19 41104934 missense probably benign 0.10
R6223:Tll2 UTSW 19 41135952 missense possibly damaging 0.54
R7047:Tll2 UTSW 19 41086240 missense probably damaging 0.99
R7155:Tll2 UTSW 19 41117284 missense possibly damaging 0.72
R7213:Tll2 UTSW 19 41120227 missense probably damaging 0.97
R7231:Tll2 UTSW 19 41086234 missense probably benign 0.02
R7390:Tll2 UTSW 19 41120169 critical splice donor site probably null
R7414:Tll2 UTSW 19 41103829 missense probably damaging 0.98
R7757:Tll2 UTSW 19 41096008 missense probably damaging 1.00
R8418:Tll2 UTSW 19 41092837 missense probably damaging 1.00
X0027:Tll2 UTSW 19 41183303 missense probably damaging 1.00
Z1177:Tll2 UTSW 19 41092734 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TAACCGGGATGTTTGAGCG -3'
(R):5'- AAAGTAAATCCAGGCAGCTGGC -3'

Sequencing Primer
(F):5'- ACAGCCTGGAAGCCTTTC -3'
(R):5'- CTCTGGGACTGGATGTCGGAC -3'
Posted On2020-07-13