Incidental Mutation 'R8166:Eif5b'
ID633753
Institutional Source Beutler Lab
Gene Symbol Eif5b
Ensembl Gene ENSMUSG00000026083
Gene Nameeukaryotic translation initiation factor 5B
SynonymsA030003E17Rik, IF2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8166 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location37998010-38055579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38048820 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 966 (T966A)
Ref Sequence ENSEMBL: ENSMUSP00000027252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027251] [ENSMUST00000027252]
Predicted Effect probably benign
Transcript: ENSMUST00000027251
SMART Domains Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082

DomainStartEndE-ValueType
BRCT 46 121 3.99e-13 SMART
low complexity region 320 342 N/A INTRINSIC
Pfam:IMS 420 620 1.9e-43 PFAM
Pfam:IMS_C 700 831 5.8e-20 PFAM
low complexity region 888 901 N/A INTRINSIC
Pfam:DUF4414 938 1071 9.7e-11 PFAM
Pfam:REV1_C 1127 1248 1.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000027252
AA Change: T966A

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: T966A

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 33 51 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 183 193 N/A INTRINSIC
coiled coil region 227 272 N/A INTRINSIC
coiled coil region 301 414 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
coiled coil region 523 554 N/A INTRINSIC
low complexity region 580 594 N/A INTRINSIC
Pfam:GTP_EFTU 625 840 4.7e-35 PFAM
Pfam:MMR_HSR1 629 753 5.1e-6 PFAM
Pfam:GTP_EFTU_D2 866 944 7.1e-11 PFAM
Pfam:IF-2 959 1066 1.4e-20 PFAM
Blast:S1 1116 1172 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,309,107 Y101N Het
Acad9 T C 3: 36,090,083 V569A probably benign Het
Actrt3 A G 3: 30,598,525 F140S probably damaging Het
AI607873 C A 1: 173,729,600 C524F possibly damaging Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Alx1 T A 10: 103,009,363 Q269L probably damaging Het
Amph G T 13: 18,948,490 A20S possibly damaging Het
Aqr T A 2: 114,113,325 M1111L possibly damaging Het
Atp10a A T 7: 58,807,522 H923L possibly damaging Het
Bmpr1a A C 14: 34,425,069 W249G probably damaging Het
Bmpr2 A T 1: 59,867,581 N611I probably damaging Het
Cadm2 A G 16: 66,953,309 L9S probably benign Het
Ccdc102a C A 8: 94,913,316 A117S possibly damaging Het
Clec4f G T 6: 83,652,642 S311R possibly damaging Het
Dchs2 T A 3: 83,354,333 I2636N probably benign Het
Dync2h1 T A 9: 7,129,089 K1809* probably null Het
Efs C T 14: 54,920,620 R108Q probably damaging Het
Fam189a1 A G 7: 64,759,405 S414P probably benign Het
Flnc A C 6: 29,433,732 N92H probably damaging Het
Gm13030 A T 4: 138,871,222 L130H unknown Het
Gm17190 A C 13: 96,082,634 R159S unknown Het
Hipk1 T C 3: 103,778,173 Y42C possibly damaging Het
Ighv8-9 G T 12: 115,468,592 P33H probably damaging Het
Igkv8-34 A G 6: 70,044,635 V15A probably benign Het
Irx5 T A 8: 92,360,084 probably null Het
Kcnh4 A G 11: 100,741,886 L925P probably benign Het
Kctd9 G A 14: 67,729,692 R153H possibly damaging Het
Lats1 A G 10: 7,702,116 T335A probably benign Het
Med20 A G 17: 47,613,102 T52A probably benign Het
Msantd4 A T 9: 4,384,095 T139S possibly damaging Het
Mtif3 T C 5: 146,959,242 T12A probably benign Het
N4bp2 T G 5: 65,820,312 S1518A probably benign Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nasp A T 4: 116,610,915 V291E probably benign Het
Ncapg2 T G 12: 116,412,416 D40E probably benign Het
Nipsnap1 A G 11: 4,884,057 D103G probably benign Het
Nsmce1 A G 7: 125,471,147 L164P probably damaging Het
Ogdhl G A 14: 32,337,806 V426I probably damaging Het
Olfr490 A G 7: 108,286,697 V143A probably benign Het
P3h2 T C 16: 25,992,822 E217G possibly damaging Het
Pnpt1 A G 11: 29,156,875 I649V probably benign Het
Pum2 G A 12: 8,721,739 A361T possibly damaging Het
Rictor G A 15: 6,769,334 probably null Het
Rps6ka4 G A 19: 6,837,443 R264W possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall1 T C 8: 89,028,518 T1278A probably benign Het
Scg2 T A 1: 79,435,583 K434N possibly damaging Het
Suclg1 T A 6: 73,260,572 V100D probably damaging Het
Tarbp1 T G 8: 126,427,128 E1528D possibly damaging Het
Tcrg-C1 A G 13: 19,216,602 N167S Het
Tshz2 C A 2: 169,883,655 T57K probably benign Het
Ttc22 G A 4: 106,634,476 R229H probably damaging Het
Vcan A G 13: 89,692,736 V1563A probably benign Het
Vmn1r68 A T 7: 10,527,961 M70K probably benign Het
Vmn2r105 A T 17: 20,208,642 I724N probably benign Het
Vmn2r96 T C 17: 18,582,482 L26P probably damaging Het
Wdr72 G A 9: 74,213,328 S955N probably benign Het
Zfp518b C A 5: 38,674,495 A56S probably damaging Het
Other mutations in Eif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Eif5b APN 1 38041719 missense probably damaging 1.00
IGL01377:Eif5b APN 1 38036098 missense probably benign
IGL01395:Eif5b APN 1 38037258 missense probably damaging 0.96
IGL01572:Eif5b APN 1 38022254 nonsense probably null
IGL01615:Eif5b APN 1 38045706 missense probably damaging 1.00
IGL02141:Eif5b APN 1 38032322 missense probably benign 0.09
IGL02260:Eif5b APN 1 38045456 missense possibly damaging 0.81
IGL02308:Eif5b APN 1 38041747 missense probably damaging 1.00
IGL03180:Eif5b APN 1 38036269 missense probably damaging 1.00
IGL03327:Eif5b APN 1 38041691 splice site probably benign
R0018:Eif5b UTSW 1 38018889 missense unknown
R0036:Eif5b UTSW 1 38019111 missense probably benign 0.23
R0137:Eif5b UTSW 1 38019243 missense probably benign 0.23
R0349:Eif5b UTSW 1 38032366 missense probably benign 0.18
R0606:Eif5b UTSW 1 38048893 missense probably damaging 1.00
R1056:Eif5b UTSW 1 38022167 missense unknown
R1225:Eif5b UTSW 1 38037628 missense probably damaging 1.00
R2043:Eif5b UTSW 1 38041819 missense probably damaging 1.00
R2163:Eif5b UTSW 1 38048794 missense probably benign 0.32
R2225:Eif5b UTSW 1 38019223 missense unknown
R2432:Eif5b UTSW 1 38019342 missense unknown
R2922:Eif5b UTSW 1 38018019 splice site probably benign
R4357:Eif5b UTSW 1 38050258 missense probably damaging 1.00
R4631:Eif5b UTSW 1 38041747 missense probably damaging 1.00
R4665:Eif5b UTSW 1 38045712 missense probably damaging 1.00
R4702:Eif5b UTSW 1 38018877 missense unknown
R4941:Eif5b UTSW 1 38051199 missense probably damaging 1.00
R4995:Eif5b UTSW 1 38051711 makesense probably null
R5020:Eif5b UTSW 1 38019069 nonsense probably null
R5175:Eif5b UTSW 1 38045387 missense probably damaging 1.00
R5375:Eif5b UTSW 1 38045754 missense possibly damaging 0.66
R5566:Eif5b UTSW 1 38045684 missense possibly damaging 0.90
R5566:Eif5b UTSW 1 38051247 missense probably damaging 1.00
R5853:Eif5b UTSW 1 38037307 missense probably damaging 1.00
R5978:Eif5b UTSW 1 37998280 splice site probably null
R6315:Eif5b UTSW 1 38018033 missense unknown
R6376:Eif5b UTSW 1 38045679 missense probably damaging 0.98
R6388:Eif5b UTSW 1 38019000 missense unknown
R6444:Eif5b UTSW 1 38036211 missense probably damaging 1.00
R6455:Eif5b UTSW 1 38019027 missense probably benign 0.23
R6810:Eif5b UTSW 1 38046660 missense probably benign 0.45
R6877:Eif5b UTSW 1 38050239 missense probably damaging 1.00
R7130:Eif5b UTSW 1 38041776 missense probably damaging 1.00
R7180:Eif5b UTSW 1 38049074 missense probably damaging 0.98
R7439:Eif5b UTSW 1 38051637 missense probably benign 0.28
R7488:Eif5b UTSW 1 38050306 missense possibly damaging 0.69
R8140:Eif5b UTSW 1 38051276 missense probably benign 0.41
R8191:Eif5b UTSW 1 38036202 missense probably damaging 0.98
R8304:Eif5b UTSW 1 38045693 missense probably benign 0.11
RF018:Eif5b UTSW 1 38021592 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTAAGTGCTGCAGAGATTTAGTC -3'
(R):5'- AGAGTTTCCAGGTTTAGCATGC -3'

Sequencing Primer
(F):5'- TGCTGCAGAGATTTAGTCTATTTTC -3'
(R):5'- CCAGGTTTAGCATGCATCAGG -3'
Posted On2020-07-13