Incidental Mutation 'R8166:Scg2'
ID 633755
Institutional Source Beutler Lab
Gene Symbol Scg2
Ensembl Gene ENSMUSG00000050711
Gene Name secretogranin II
Synonyms SgII, Chgc
MMRRC Submission 067592-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8166 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 79412386-79417837 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79413300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 434 (K434N)
Ref Sequence ENSEMBL: ENSMUSP00000139740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049972] [ENSMUST00000185234]
AlphaFold Q03517
Predicted Effect possibly damaging
Transcript: ENSMUST00000049972
AA Change: K474N

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062556
Gene: ENSMUSG00000050711
AA Change: K474N

DomainStartEndE-ValueType
Pfam:Granin 27 614 7.2e-235 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000185234
AA Change: K434N

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139740
Gene: ENSMUSG00000050711
AA Change: K434N

DomainStartEndE-ValueType
Pfam:Granin 27 319 1.4e-123 PFAM
Pfam:Granin 316 574 7.1e-91 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The full-length protein is cleaved to produce the active peptide secretoneurin, which exerts chemotaxic effects on specific cell types, and EM66, whose function is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,144,232 (GRCm39) V569A probably benign Het
Actrt3 A G 3: 30,652,674 (GRCm39) F140S probably damaging Het
Alx1 T A 10: 102,845,224 (GRCm39) Q269L probably damaging Het
Amph G T 13: 19,132,660 (GRCm39) A20S possibly damaging Het
Aqr T A 2: 113,943,806 (GRCm39) M1111L possibly damaging Het
Atp10a A T 7: 58,457,270 (GRCm39) H923L possibly damaging Het
Bmpr1a A C 14: 34,147,026 (GRCm39) W249G probably damaging Het
Bmpr2 A T 1: 59,906,740 (GRCm39) N611I probably damaging Het
Cadm2 A G 16: 66,750,197 (GRCm39) L9S probably benign Het
Ccdc102a C A 8: 95,639,944 (GRCm39) A117S possibly damaging Het
Clec4f G T 6: 83,629,624 (GRCm39) S311R possibly damaging Het
Dchs2 T A 3: 83,261,640 (GRCm39) I2636N probably benign Het
Dync2h1 T A 9: 7,129,089 (GRCm39) K1809* probably null Het
Efs C T 14: 55,158,077 (GRCm39) R108Q probably damaging Het
Eif5b A G 1: 38,087,901 (GRCm39) T966A probably benign Het
Entrep2 A G 7: 64,409,153 (GRCm39) S414P probably benign Het
Flnc A C 6: 29,433,731 (GRCm39) N92H probably damaging Het
Gm13030 A T 4: 138,598,533 (GRCm39) L130H unknown Het
Gm17190 A C 13: 96,219,142 (GRCm39) R159S unknown Het
Hipk1 T C 3: 103,685,489 (GRCm39) Y42C possibly damaging Het
Ifi207 C A 1: 173,557,166 (GRCm39) C524F possibly damaging Het
Ifi207 A C 1: 173,557,504 (GRCm39) S411R probably benign Het
Ighv8-9 G T 12: 115,432,212 (GRCm39) P33H probably damaging Het
Igkv8-34 A G 6: 70,021,619 (GRCm39) V15A probably benign Het
Irx5 T A 8: 93,086,712 (GRCm39) probably null Het
Kcnh4 A G 11: 100,632,712 (GRCm39) L925P probably benign Het
Kctd9 G A 14: 67,967,141 (GRCm39) R153H possibly damaging Het
Lats1 A G 10: 7,577,880 (GRCm39) T335A probably benign Het
Med20 A G 17: 47,924,027 (GRCm39) T52A probably benign Het
Msantd4 A T 9: 4,384,095 (GRCm39) T139S possibly damaging Het
Mtif3 T C 5: 146,896,052 (GRCm39) T12A probably benign Het
N4bp2 T G 5: 65,977,655 (GRCm39) S1518A probably benign Het
Naip2 T C 13: 100,298,515 (GRCm39) N507S probably benign Het
Nasp A T 4: 116,468,112 (GRCm39) V291E probably benign Het
Ncapg2 T G 12: 116,376,036 (GRCm39) D40E probably benign Het
Nipsnap1 A G 11: 4,834,057 (GRCm39) D103G probably benign Het
Nsmce1 A G 7: 125,070,319 (GRCm39) L164P probably damaging Het
Ogdhl G A 14: 32,059,763 (GRCm39) V426I probably damaging Het
Or5p66 A G 7: 107,885,904 (GRCm39) V143A probably benign Het
P3h2 T C 16: 25,811,572 (GRCm39) E217G possibly damaging Het
Pnpt1 A G 11: 29,106,875 (GRCm39) I649V probably benign Het
Prxl2c A T 13: 64,456,921 (GRCm39) Y101N Het
Pum2 G A 12: 8,771,739 (GRCm39) A361T possibly damaging Het
Rictor G A 15: 6,798,815 (GRCm39) probably null Het
Rps6ka4 G A 19: 6,814,811 (GRCm39) R264W possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,229,116 (GRCm39) probably benign Het
Sall1 T C 8: 89,755,146 (GRCm39) T1278A probably benign Het
Suclg1 T A 6: 73,237,555 (GRCm39) V100D probably damaging Het
Tarbp1 T G 8: 127,153,867 (GRCm39) E1528D possibly damaging Het
Trgc1 A G 13: 19,400,772 (GRCm39) N167S Het
Tshz2 C A 2: 169,725,575 (GRCm39) T57K probably benign Het
Ttc22 G A 4: 106,491,673 (GRCm39) R229H probably damaging Het
Vcan A G 13: 89,840,855 (GRCm39) V1563A probably benign Het
Vmn1r68 A T 7: 10,261,888 (GRCm39) M70K probably benign Het
Vmn2r105 A T 17: 20,428,904 (GRCm39) I724N probably benign Het
Vmn2r96 T C 17: 18,802,744 (GRCm39) L26P probably damaging Het
Wdr72 G A 9: 74,120,610 (GRCm39) S955N probably benign Het
Zfp518b C A 5: 38,831,838 (GRCm39) A56S probably damaging Het
Other mutations in Scg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Scg2 APN 1 79,414,538 (GRCm39) missense probably benign 0.16
IGL02083:Scg2 APN 1 79,413,941 (GRCm39) missense probably benign 0.00
IGL02316:Scg2 APN 1 79,413,398 (GRCm39) missense probably damaging 1.00
IGL02338:Scg2 APN 1 79,414,210 (GRCm39) missense possibly damaging 0.93
R0281:Scg2 UTSW 1 79,413,229 (GRCm39) missense possibly damaging 0.95
R0384:Scg2 UTSW 1 79,413,266 (GRCm39) missense probably benign 0.42
R0501:Scg2 UTSW 1 79,413,320 (GRCm39) missense probably damaging 1.00
R0909:Scg2 UTSW 1 79,413,499 (GRCm39) missense possibly damaging 0.74
R1773:Scg2 UTSW 1 79,413,352 (GRCm39) missense probably benign 0.04
R2254:Scg2 UTSW 1 79,414,217 (GRCm39) missense probably damaging 1.00
R4074:Scg2 UTSW 1 79,414,574 (GRCm39) missense probably damaging 0.97
R4076:Scg2 UTSW 1 79,414,574 (GRCm39) missense probably damaging 0.97
R4097:Scg2 UTSW 1 79,413,538 (GRCm39) missense probably damaging 0.99
R4560:Scg2 UTSW 1 79,412,898 (GRCm39) missense probably damaging 1.00
R4621:Scg2 UTSW 1 79,414,381 (GRCm39) missense probably benign 0.08
R4876:Scg2 UTSW 1 79,413,636 (GRCm39) missense probably damaging 1.00
R4944:Scg2 UTSW 1 79,414,193 (GRCm39) nonsense probably null
R5829:Scg2 UTSW 1 79,414,637 (GRCm39) missense probably damaging 1.00
R6158:Scg2 UTSW 1 79,413,117 (GRCm39) missense probably damaging 1.00
R6248:Scg2 UTSW 1 79,414,023 (GRCm39) missense probably benign 0.29
R6365:Scg2 UTSW 1 79,413,017 (GRCm39) missense probably benign
R6459:Scg2 UTSW 1 79,414,007 (GRCm39) missense probably damaging 1.00
R6676:Scg2 UTSW 1 79,413,499 (GRCm39) missense possibly damaging 0.74
R6693:Scg2 UTSW 1 79,413,737 (GRCm39) missense probably benign 0.01
R7259:Scg2 UTSW 1 79,414,702 (GRCm39) missense probably benign
R7393:Scg2 UTSW 1 79,412,948 (GRCm39) missense probably damaging 1.00
R7578:Scg2 UTSW 1 79,414,612 (GRCm39) missense probably damaging 0.99
R7608:Scg2 UTSW 1 79,413,898 (GRCm39) missense probably benign 0.00
R8247:Scg2 UTSW 1 79,414,236 (GRCm39) missense possibly damaging 0.92
R8296:Scg2 UTSW 1 79,413,222 (GRCm39) missense probably benign 0.13
R8308:Scg2 UTSW 1 79,414,576 (GRCm39) missense probably benign 0.18
R8789:Scg2 UTSW 1 79,413,500 (GRCm39) missense probably benign 0.05
R9252:Scg2 UTSW 1 79,414,069 (GRCm39) missense probably damaging 0.98
R9286:Scg2 UTSW 1 79,413,653 (GRCm39) missense probably damaging 1.00
R9489:Scg2 UTSW 1 79,412,936 (GRCm39) missense probably damaging 1.00
R9605:Scg2 UTSW 1 79,412,936 (GRCm39) missense probably damaging 1.00
Z1176:Scg2 UTSW 1 79,414,506 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGCTGCTCTTCTTCTTGGAG -3'
(R):5'- TAAGATGCTCTCCAAGGGTGGG -3'

Sequencing Primer
(F):5'- TCCTCTGAGGAGACTGGACTG -3'
(R):5'- TCTCCAAGGGTGGGTATCC -3'
Posted On 2020-07-13