Mutagenetix > Incidental Mutation

Incidental Mutation 'R8166:Scg2'

633755

Institutional Source

Beutler Lab

Gene Symbol

Scg2

Ensembl Gene

ENSMUSG00000050711

Gene Name

secretogranin II

Synonyms

SgII, Chgc

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8166 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79434669-79440120 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79435583 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 434 (K434N)

Ref Sequence

ENSEMBL: ENSMUSP00000139740 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049972] [ENSMUST00000185234]

AlphaFold

Q03517

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049972
AA Change: K474N

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000062556
Gene: ENSMUSG00000050711
AA Change: K474N

Domain	Start	End	E-Value	Type
Pfam:Granin	27	614	7.2e-235	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185234
AA Change: K434N

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000139740
Gene: ENSMUSG00000050711
AA Change: K434N

Domain	Start	End	E-Value	Type
Pfam:Granin	27	319	1.4e-123	PFAM
Pfam:Granin	316	574	7.1e-91	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The full-length protein is cleaved to produce the active peptide secretoneurin, which exerts chemotaxic effects on specific cell types, and EM66, whose function is unknown. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	A	T	13: 64,309,107	Y101N		Het
Acad9	T	C	3: 36,090,083	V569A	probably benign	Het
Actrt3	A	G	3: 30,598,525	F140S	probably damaging	Het
Alx1	T	A	10: 103,009,363	Q269L	probably damaging	Het
Amph	G	T	13: 18,948,490	A20S	possibly damaging	Het
Aqr	T	A	2: 114,113,325	M1111L	possibly damaging	Het
Atp10a	A	T	7: 58,807,522	H923L	possibly damaging	Het
Bmpr1a	A	C	14: 34,425,069	W249G	probably damaging	Het
Bmpr2	A	T	1: 59,867,581	N611I	probably damaging	Het
Cadm2	A	G	16: 66,953,309	L9S	probably benign	Het
Ccdc102a	C	A	8: 94,913,316	A117S	possibly damaging	Het
Clec4f	G	T	6: 83,652,642	S311R	possibly damaging	Het
Dchs2	T	A	3: 83,354,333	I2636N	probably benign	Het
Dync2h1	T	A	9: 7,129,089	K1809*	probably null	Het
Efs	C	T	14: 54,920,620	R108Q	probably damaging	Het
Eif5b	A	G	1: 38,048,820	T966A	probably benign	Het
Fam189a1	A	G	7: 64,759,405	S414P	probably benign	Het
Flnc	A	C	6: 29,433,732	N92H	probably damaging	Het
Gm13030	A	T	4: 138,871,222	L130H	unknown	Het
Gm17190	A	C	13: 96,082,634	R159S	unknown	Het
Hipk1	T	C	3: 103,778,173	Y42C	possibly damaging	Het
Ifi207	C	A	1: 173,729,600	C524F	possibly damaging	Het
Ifi207	A	C	1: 173,729,938	S411R	probably benign	Het
Ighv8-9	G	T	12: 115,468,592	P33H	probably damaging	Het
Igkv8-34	A	G	6: 70,044,635	V15A	probably benign	Het
Irx5	T	A	8: 92,360,084		probably null	Het
Kcnh4	A	G	11: 100,741,886	L925P	probably benign	Het
Kctd9	G	A	14: 67,729,692	R153H	possibly damaging	Het
Lats1	A	G	10: 7,702,116	T335A	probably benign	Het
Med20	A	G	17: 47,613,102	T52A	probably benign	Het
Msantd4	A	T	9: 4,384,095	T139S	possibly damaging	Het
Mtif3	T	C	5: 146,959,242	T12A	probably benign	Het
N4bp2	T	G	5: 65,820,312	S1518A	probably benign	Het
Naip2	T	C	13: 100,162,007	N507S	probably benign	Het
Nasp	A	T	4: 116,610,915	V291E	probably benign	Het
Ncapg2	T	G	12: 116,412,416	D40E	probably benign	Het
Nipsnap1	A	G	11: 4,884,057	D103G	probably benign	Het
Nsmce1	A	G	7: 125,471,147	L164P	probably damaging	Het
Ogdhl	G	A	14: 32,337,806	V426I	probably damaging	Het
Olfr490	A	G	7: 108,286,697	V143A	probably benign	Het
P3h2	T	C	16: 25,992,822	E217G	possibly damaging	Het
Pnpt1	A	G	11: 29,156,875	I649V	probably benign	Het
Pum2	G	A	12: 8,721,739	A361T	possibly damaging	Het
Rictor	G	A	15: 6,769,334		probably null	Het
Rps6ka4	G	A	19: 6,837,443	R264W	possibly damaging	Het
Rsf1	G	GACGGCGGCA	7: 97,579,909		probably benign	Het
Sall1	T	C	8: 89,028,518	T1278A	probably benign	Het
Suclg1	T	A	6: 73,260,572	V100D	probably damaging	Het
Tarbp1	T	G	8: 126,427,128	E1528D	possibly damaging	Het
Tcrg-C1	A	G	13: 19,216,602	N167S		Het
Tshz2	C	A	2: 169,883,655	T57K	probably benign	Het
Ttc22	G	A	4: 106,634,476	R229H	probably damaging	Het
Vcan	A	G	13: 89,692,736	V1563A	probably benign	Het
Vmn1r68	A	T	7: 10,527,961	M70K	probably benign	Het
Vmn2r105	A	T	17: 20,208,642	I724N	probably benign	Het
Vmn2r96	T	C	17: 18,582,482	L26P	probably damaging	Het
Wdr72	G	A	9: 74,213,328	S955N	probably benign	Het
Zfp518b	C	A	5: 38,674,495	A56S	probably damaging	Het

Other mutations in Scg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01347:Scg2	APN	1	79436821	missense	probably benign	0.16
IGL02083:Scg2	APN	1	79436224	missense	probably benign	0.00
IGL02316:Scg2	APN	1	79435681	missense	probably damaging	1.00
IGL02338:Scg2	APN	1	79436493	missense	possibly damaging	0.93
R0281:Scg2	UTSW	1	79435512	missense	possibly damaging	0.95
R0384:Scg2	UTSW	1	79435549	missense	probably benign	0.42
R0501:Scg2	UTSW	1	79435603	missense	probably damaging	1.00
R0909:Scg2	UTSW	1	79435782	missense	possibly damaging	0.74
R1773:Scg2	UTSW	1	79435635	missense	probably benign	0.04
R2254:Scg2	UTSW	1	79436500	missense	probably damaging	1.00
R4074:Scg2	UTSW	1	79436857	missense	probably damaging	0.97
R4076:Scg2	UTSW	1	79436857	missense	probably damaging	0.97
R4097:Scg2	UTSW	1	79435821	missense	probably damaging	0.99
R4560:Scg2	UTSW	1	79435181	missense	probably damaging	1.00
R4621:Scg2	UTSW	1	79436664	missense	probably benign	0.08
R4876:Scg2	UTSW	1	79435919	missense	probably damaging	1.00
R4944:Scg2	UTSW	1	79436476	nonsense	probably null
R5829:Scg2	UTSW	1	79436920	missense	probably damaging	1.00
R6158:Scg2	UTSW	1	79435400	missense	probably damaging	1.00
R6248:Scg2	UTSW	1	79436306	missense	probably benign	0.29
R6365:Scg2	UTSW	1	79435300	missense	probably benign
R6459:Scg2	UTSW	1	79436290	missense	probably damaging	1.00
R6676:Scg2	UTSW	1	79435782	missense	possibly damaging	0.74
R6693:Scg2	UTSW	1	79436020	missense	probably benign	0.01
R7259:Scg2	UTSW	1	79436985	missense	probably benign
R7393:Scg2	UTSW	1	79435231	missense	probably damaging	1.00
R7578:Scg2	UTSW	1	79436895	missense	probably damaging	0.99
R7608:Scg2	UTSW	1	79436181	missense	probably benign	0.00
R8247:Scg2	UTSW	1	79436519	missense	possibly damaging	0.92
R8296:Scg2	UTSW	1	79435505	missense	probably benign	0.13
R8308:Scg2	UTSW	1	79436859	missense	probably benign	0.18
R8789:Scg2	UTSW	1	79435783	missense	probably benign	0.05
R9252:Scg2	UTSW	1	79436352	missense	probably damaging	0.98
R9286:Scg2	UTSW	1	79435936	missense	probably damaging	1.00
R9489:Scg2	UTSW	1	79435219	missense	probably damaging	1.00
R9605:Scg2	UTSW	1	79435219	missense	probably damaging	1.00
Z1176:Scg2	UTSW	1	79436789	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AGCTGCTCTTCTTCTTGGAG -3'
(R):5'- TAAGATGCTCTCCAAGGGTGGG -3'

Sequencing Primer
(F):5'- TCCTCTGAGGAGACTGGACTG -3'
(R):5'- TCTCCAAGGGTGGGTATCC -3'

Posted On

2020-07-13