Mutagenetix > Incidental Mutations

Incidental Mutation 'R8166:Aqr'

633758

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8166 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 114113325 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1111 (M1111L)

Ref Sequence

ENSEMBL: ENSMUSP00000047157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043160
AA Change: M1111L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: M1111L

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102543
AA Change: M1111L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: M1111L

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (59/59)

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	A	T	13: 64,309,107	Y101N		Het
Acad9	T	C	3: 36,090,083	V569A	probably benign	Het
Actrt3	A	G	3: 30,598,525	F140S	probably damaging	Het
AI607873	C	A	1: 173,729,600	C524F	possibly damaging	Het
AI607873	A	C	1: 173,729,938	S411R	probably benign	Het
Alx1	T	A	10: 103,009,363	Q269L	probably damaging	Het
Amph	G	T	13: 18,948,490	A20S	possibly damaging	Het
Atp10a	A	T	7: 58,807,522	H923L	possibly damaging	Het
Bmpr1a	A	C	14: 34,425,069	W249G	probably damaging	Het
Bmpr2	A	T	1: 59,867,581	N611I	probably damaging	Het
Cadm2	A	G	16: 66,953,309	L9S	probably benign	Het
Ccdc102a	C	A	8: 94,913,316	A117S	possibly damaging	Het
Clec4f	G	T	6: 83,652,642	S311R	possibly damaging	Het
Dchs2	T	A	3: 83,354,333	I2636N	probably benign	Het
Dync2h1	T	A	9: 7,129,089	K1809*	probably null	Het
Efs	C	T	14: 54,920,620	R108Q	probably damaging	Het
Eif5b	A	G	1: 38,048,820	T966A	probably benign	Het
Fam189a1	A	G	7: 64,759,405	S414P	probably benign	Het
Flnc	A	C	6: 29,433,732	N92H	probably damaging	Het
Gm13030	A	T	4: 138,871,222	L130H	unknown	Het
Gm17190	A	C	13: 96,082,634	R159S	unknown	Het
Hipk1	T	C	3: 103,778,173	Y42C	possibly damaging	Het
Ighv8-9	G	T	12: 115,468,592	P33H	probably damaging	Het
Igkv8-34	A	G	6: 70,044,635	V15A	probably benign	Het
Irx5	T	A	8: 92,360,084		probably null	Het
Kcnh4	A	G	11: 100,741,886	L925P	probably benign	Het
Kctd9	G	A	14: 67,729,692	R153H	possibly damaging	Het
Lats1	A	G	10: 7,702,116	T335A	probably benign	Het
Med20	A	G	17: 47,613,102	T52A	probably benign	Het
Msantd4	A	T	9: 4,384,095	T139S	possibly damaging	Het
Mtif3	T	C	5: 146,959,242	T12A	probably benign	Het
N4bp2	T	G	5: 65,820,312	S1518A	probably benign	Het
Naip2	T	C	13: 100,162,007	N507S	probably benign	Het
Nasp	A	T	4: 116,610,915	V291E	probably benign	Het
Ncapg2	T	G	12: 116,412,416	D40E	probably benign	Het
Nipsnap1	A	G	11: 4,884,057	D103G	probably benign	Het
Nsmce1	A	G	7: 125,471,147	L164P	probably damaging	Het
Ogdhl	G	A	14: 32,337,806	V426I	probably damaging	Het
Olfr490	A	G	7: 108,286,697	V143A	probably benign	Het
P3h2	T	C	16: 25,992,822	E217G	possibly damaging	Het
Pnpt1	A	G	11: 29,156,875	I649V	probably benign	Het
Pum2	G	A	12: 8,721,739	A361T	possibly damaging	Het
Rictor	G	A	15: 6,769,334		probably null	Het
Rps6ka4	G	A	19: 6,837,443	R264W	possibly damaging	Het
Rsf1	G	GACGGCGGCA	7: 97,579,909		probably benign	Het
Sall1	T	C	8: 89,028,518	T1278A	probably benign	Het
Scg2	T	A	1: 79,435,583	K434N	possibly damaging	Het
Suclg1	T	A	6: 73,260,572	V100D	probably damaging	Het
Tarbp1	T	G	8: 126,427,128	E1528D	possibly damaging	Het
Tcrg-C1	A	G	13: 19,216,602	N167S		Het
Tshz2	C	A	2: 169,883,655	T57K	probably benign	Het
Ttc22	G	A	4: 106,634,476	R229H	probably damaging	Het
Vcan	A	G	13: 89,692,736	V1563A	probably benign	Het
Vmn1r68	A	T	7: 10,527,961	M70K	probably benign	Het
Vmn2r105	A	T	17: 20,208,642	I724N	probably benign	Het
Vmn2r96	T	C	17: 18,582,482	L26P	probably damaging	Het
Wdr72	G	A	9: 74,213,328	S955N	probably benign	Het
Zfp518b	C	A	5: 38,674,495	A56S	probably damaging	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- TCCTAGGTTTGTAGAGGAGGCTAAAAC -3'
(R):5'- GCTGCTGAAGGTTGGGAATC -3'

Sequencing Primer
(F):5'- GAGGAGGCTAAAACTTTTTGTAACAG -3'
(R):5'- CATGATGTCGTCTGATGAACAG -3'

Posted On

2020-07-13