Incidental Mutation 'R8166:Dchs2'
ID633762
Institutional Source Beutler Lab
Gene Symbol Dchs2
Ensembl Gene ENSMUSG00000102692
Gene Namedachsous cadherin related 2
SynonymsLOC229459
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R8166 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location83127948-83357209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83354333 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2636 (I2636N)
Ref Sequence ENSEMBL: ENSMUSP00000141425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191829]
Predicted Effect probably benign
Transcript: ENSMUST00000191829
AA Change: I2636N

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141425
Gene: ENSMUSG00000102692
AA Change: I2636N

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
CA 70 149 1.6e-8 SMART
CA 173 278 1.9e-9 SMART
CA 302 395 2e-33 SMART
CA 423 522 3.2e-7 SMART
CA 546 642 1.1e-29 SMART
CA 666 750 5.6e-22 SMART
CA 774 855 1.5e-8 SMART
CA 876 958 4.2e-19 SMART
CA 982 1060 3e-8 SMART
CA 1067 1168 9.3e-7 SMART
CA 1192 1271 1.1e-28 SMART
CA 1299 1379 4e-16 SMART
CA 1403 1486 6.1e-16 SMART
CA 1510 1596 3.5e-18 SMART
CA 1619 1700 4.4e-27 SMART
CA 1724 1805 6.4e-27 SMART
CA 1828 1909 4.3e-29 SMART
CA 1933 2014 3.4e-27 SMART
CA 2038 2116 4.2e-7 SMART
CA 2139 2218 2.5e-15 SMART
CA 2242 2323 2.1e-34 SMART
CA 2346 2423 3e-24 SMART
CA 2447 2525 2e-17 SMART
CA 2549 2641 9.8e-16 SMART
CA 2665 2745 2.3e-24 SMART
CA 2769 2856 5.9e-19 SMART
CA 2880 2959 1e-3 SMART
transmembrane domain 2973 2995 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,309,107 Y101N Het
Acad9 T C 3: 36,090,083 V569A probably benign Het
Actrt3 A G 3: 30,598,525 F140S probably damaging Het
AI607873 C A 1: 173,729,600 C524F possibly damaging Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Alx1 T A 10: 103,009,363 Q269L probably damaging Het
Amph G T 13: 18,948,490 A20S possibly damaging Het
Aqr T A 2: 114,113,325 M1111L possibly damaging Het
Atp10a A T 7: 58,807,522 H923L possibly damaging Het
Bmpr1a A C 14: 34,425,069 W249G probably damaging Het
Bmpr2 A T 1: 59,867,581 N611I probably damaging Het
Cadm2 A G 16: 66,953,309 L9S probably benign Het
Ccdc102a C A 8: 94,913,316 A117S possibly damaging Het
Clec4f G T 6: 83,652,642 S311R possibly damaging Het
Dync2h1 T A 9: 7,129,089 K1809* probably null Het
Efs C T 14: 54,920,620 R108Q probably damaging Het
Eif5b A G 1: 38,048,820 T966A probably benign Het
Fam189a1 A G 7: 64,759,405 S414P probably benign Het
Flnc A C 6: 29,433,732 N92H probably damaging Het
Gm13030 A T 4: 138,871,222 L130H unknown Het
Gm17190 A C 13: 96,082,634 R159S unknown Het
Hipk1 T C 3: 103,778,173 Y42C possibly damaging Het
Ighv8-9 G T 12: 115,468,592 P33H probably damaging Het
Igkv8-34 A G 6: 70,044,635 V15A probably benign Het
Irx5 T A 8: 92,360,084 probably null Het
Kcnh4 A G 11: 100,741,886 L925P probably benign Het
Kctd9 G A 14: 67,729,692 R153H possibly damaging Het
Lats1 A G 10: 7,702,116 T335A probably benign Het
Med20 A G 17: 47,613,102 T52A probably benign Het
Msantd4 A T 9: 4,384,095 T139S possibly damaging Het
Mtif3 T C 5: 146,959,242 T12A probably benign Het
N4bp2 T G 5: 65,820,312 S1518A probably benign Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nasp A T 4: 116,610,915 V291E probably benign Het
Ncapg2 T G 12: 116,412,416 D40E probably benign Het
Nipsnap1 A G 11: 4,884,057 D103G probably benign Het
Nsmce1 A G 7: 125,471,147 L164P probably damaging Het
Ogdhl G A 14: 32,337,806 V426I probably damaging Het
Olfr490 A G 7: 108,286,697 V143A probably benign Het
P3h2 T C 16: 25,992,822 E217G possibly damaging Het
Pnpt1 A G 11: 29,156,875 I649V probably benign Het
Pum2 G A 12: 8,721,739 A361T possibly damaging Het
Rictor G A 15: 6,769,334 probably null Het
Rps6ka4 G A 19: 6,837,443 R264W possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall1 T C 8: 89,028,518 T1278A probably benign Het
Scg2 T A 1: 79,435,583 K434N possibly damaging Het
Suclg1 T A 6: 73,260,572 V100D probably damaging Het
Tarbp1 T G 8: 126,427,128 E1528D possibly damaging Het
Tcrg-C1 A G 13: 19,216,602 N167S Het
Tshz2 C A 2: 169,883,655 T57K probably benign Het
Ttc22 G A 4: 106,634,476 R229H probably damaging Het
Vcan A G 13: 89,692,736 V1563A probably benign Het
Vmn1r68 A T 7: 10,527,961 M70K probably benign Het
Vmn2r105 A T 17: 20,208,642 I724N probably benign Het
Vmn2r96 T C 17: 18,582,482 L26P probably damaging Het
Wdr72 G A 9: 74,213,328 S955N probably benign Het
Zfp518b C A 5: 38,674,495 A56S probably damaging Het
Other mutations in Dchs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1707:Dchs2 UTSW 3 83127605 unclassified probably benign
R5857:Dchs2 UTSW 3 83270313 missense possibly damaging 0.79
R5897:Dchs2 UTSW 3 83285410 missense possibly damaging 0.95
R5959:Dchs2 UTSW 3 83325418 missense probably benign 0.01
R6007:Dchs2 UTSW 3 83346227 missense probably damaging 0.99
R6054:Dchs2 UTSW 3 83346236 missense probably benign 0.00
R6059:Dchs2 UTSW 3 83355736 missense probably benign 0.06
R6075:Dchs2 UTSW 3 83355061 missense possibly damaging 0.68
R6379:Dchs2 UTSW 3 83355146 missense probably damaging 1.00
R6393:Dchs2 UTSW 3 83129911 missense probably damaging 1.00
R6405:Dchs2 UTSW 3 83354263 missense probably benign 0.01
R6432:Dchs2 UTSW 3 83271118 missense possibly damaging 0.96
R6434:Dchs2 UTSW 3 83269270 missense probably damaging 1.00
R6561:Dchs2 UTSW 3 83129169 missense probably benign 0.04
R6798:Dchs2 UTSW 3 83348286 missense probably damaging 1.00
R6801:Dchs2 UTSW 3 83128534 missense probably benign 0.00
R6855:Dchs2 UTSW 3 83348194 missense probably benign 0.08
R6956:Dchs2 UTSW 3 83353926 missense probably benign 0.00
R7090:Dchs2 UTSW 3 83348274 missense probably benign 0.03
R7249:Dchs2 UTSW 3 83128029 nonsense probably null
R7252:Dchs2 UTSW 3 83325303 missense probably benign 0.04
R7462:Dchs2 UTSW 3 83346155 splice site probably null
R7482:Dchs2 UTSW 3 83248725 missense possibly damaging 0.68
R7487:Dchs2 UTSW 3 83356306 missense probably damaging 0.99
R7529:Dchs2 UTSW 3 83354398 missense possibly damaging 0.89
R7542:Dchs2 UTSW 3 83269284 missense probably benign 0.16
R7544:Dchs2 UTSW 3 83355127 missense probably damaging 1.00
R7547:Dchs2 UTSW 3 83356127 missense probably damaging 0.96
R7587:Dchs2 UTSW 3 83304515 missense probably benign
R7632:Dchs2 UTSW 3 83348050 missense probably benign 0.00
R7694:Dchs2 UTSW 3 83129482 missense probably damaging 1.00
R7701:Dchs2 UTSW 3 83346206 missense possibly damaging 0.83
R7746:Dchs2 UTSW 3 83128057 missense possibly damaging 0.94
R7838:Dchs2 UTSW 3 83304527 missense probably benign 0.01
R7886:Dchs2 UTSW 3 83305085 missense probably damaging 1.00
R8055:Dchs2 UTSW 3 83129725 missense probably benign 0.00
R8068:Dchs2 UTSW 3 83300438 missense probably benign 0.12
R8094:Dchs2 UTSW 3 83355622 missense probably benign 0.02
R8160:Dchs2 UTSW 3 83270805 missense probably benign 0.19
R8278:Dchs2 UTSW 3 83271003 missense probably damaging 1.00
R8422:Dchs2 UTSW 3 83325263 missense probably benign 0.30
R8506:Dchs2 UTSW 3 83301174 missense probably benign 0.17
R8517:Dchs2 UTSW 3 83271112 missense probably damaging 0.96
RF012:Dchs2 UTSW 3 83355068 missense probably benign 0.03
Z1177:Dchs2 UTSW 3 83271140 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GAAACCAGCCTACTTGGTTCAG -3'
(R):5'- CTGTTTCCTCGTAATCCAGAGG -3'

Sequencing Primer
(F):5'- AGCCTACTTGGTTCAGAACATC -3'
(R):5'- TCGTAATCCAGAGGTTTCACC -3'
Posted On2020-07-13