Incidental Mutation 'R8166:Hipk1'
ID633763
Institutional Source Beutler Lab
Gene Symbol Hipk1
Ensembl Gene ENSMUSG00000008730
Gene Namehomeodomain interacting protein kinase 1
Synonyms1110062K04Rik, Myak
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8166 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location103739815-103791563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103778173 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 42 (Y42C)
Ref Sequence ENSEMBL: ENSMUSP00000029438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029438] [ENSMUST00000106845] [ENSMUST00000118317] [ENSMUST00000137078]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029438
AA Change: Y42C

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029438
Gene: ENSMUSG00000008730
AA Change: Y42C

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106845
AA Change: Y42C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102458
Gene: ENSMUSG00000008730
AA Change: Y42C

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 1002 1018 N/A INTRINSIC
low complexity region 1050 1066 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118317
AA Change: Y42C

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113998
Gene: ENSMUSG00000008730
AA Change: Y42C

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137078
AA Change: Y42C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120396
Gene: ENSMUSG00000008730
AA Change: Y42C

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 672 695 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr family of protein kinases and HIPK subfamily. It phosphorylates homeodomain transcription factors and may also function as a co-repressor for homeodomain transcription factors. Alternative splicing results in four transcript variants encoding four distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile, do not develop spontaneous tumors, and are resistant to DMBA-induced skin tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,309,107 Y101N Het
Acad9 T C 3: 36,090,083 V569A probably benign Het
Actrt3 A G 3: 30,598,525 F140S probably damaging Het
AI607873 C A 1: 173,729,600 C524F possibly damaging Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Alx1 T A 10: 103,009,363 Q269L probably damaging Het
Amph G T 13: 18,948,490 A20S possibly damaging Het
Aqr T A 2: 114,113,325 M1111L possibly damaging Het
Atp10a A T 7: 58,807,522 H923L possibly damaging Het
Bmpr1a A C 14: 34,425,069 W249G probably damaging Het
Bmpr2 A T 1: 59,867,581 N611I probably damaging Het
Cadm2 A G 16: 66,953,309 L9S probably benign Het
Ccdc102a C A 8: 94,913,316 A117S possibly damaging Het
Clec4f G T 6: 83,652,642 S311R possibly damaging Het
Dchs2 T A 3: 83,354,333 I2636N probably benign Het
Dync2h1 T A 9: 7,129,089 K1809* probably null Het
Efs C T 14: 54,920,620 R108Q probably damaging Het
Eif5b A G 1: 38,048,820 T966A probably benign Het
Fam189a1 A G 7: 64,759,405 S414P probably benign Het
Flnc A C 6: 29,433,732 N92H probably damaging Het
Gm13030 A T 4: 138,871,222 L130H unknown Het
Gm17190 A C 13: 96,082,634 R159S unknown Het
Ighv8-9 G T 12: 115,468,592 P33H probably damaging Het
Igkv8-34 A G 6: 70,044,635 V15A probably benign Het
Irx5 T A 8: 92,360,084 probably null Het
Kcnh4 A G 11: 100,741,886 L925P probably benign Het
Kctd9 G A 14: 67,729,692 R153H possibly damaging Het
Lats1 A G 10: 7,702,116 T335A probably benign Het
Med20 A G 17: 47,613,102 T52A probably benign Het
Msantd4 A T 9: 4,384,095 T139S possibly damaging Het
Mtif3 T C 5: 146,959,242 T12A probably benign Het
N4bp2 T G 5: 65,820,312 S1518A probably benign Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nasp A T 4: 116,610,915 V291E probably benign Het
Ncapg2 T G 12: 116,412,416 D40E probably benign Het
Nipsnap1 A G 11: 4,884,057 D103G probably benign Het
Nsmce1 A G 7: 125,471,147 L164P probably damaging Het
Ogdhl G A 14: 32,337,806 V426I probably damaging Het
Olfr490 A G 7: 108,286,697 V143A probably benign Het
P3h2 T C 16: 25,992,822 E217G possibly damaging Het
Pnpt1 A G 11: 29,156,875 I649V probably benign Het
Pum2 G A 12: 8,721,739 A361T possibly damaging Het
Rictor G A 15: 6,769,334 probably null Het
Rps6ka4 G A 19: 6,837,443 R264W possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall1 T C 8: 89,028,518 T1278A probably benign Het
Scg2 T A 1: 79,435,583 K434N possibly damaging Het
Suclg1 T A 6: 73,260,572 V100D probably damaging Het
Tarbp1 T G 8: 126,427,128 E1528D possibly damaging Het
Tcrg-C1 A G 13: 19,216,602 N167S Het
Tshz2 C A 2: 169,883,655 T57K probably benign Het
Ttc22 G A 4: 106,634,476 R229H probably damaging Het
Vcan A G 13: 89,692,736 V1563A probably benign Het
Vmn1r68 A T 7: 10,527,961 M70K probably benign Het
Vmn2r105 A T 17: 20,208,642 I724N probably benign Het
Vmn2r96 T C 17: 18,582,482 L26P probably damaging Het
Wdr72 G A 9: 74,213,328 S955N probably benign Het
Zfp518b C A 5: 38,674,495 A56S probably damaging Het
Other mutations in Hipk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Hipk1 APN 3 103778160 missense possibly damaging 0.49
IGL01024:Hipk1 APN 3 103760636 missense probably benign 0.31
IGL01069:Hipk1 APN 3 103777699 missense possibly damaging 0.95
IGL01798:Hipk1 APN 3 103761559 missense probably damaging 0.99
IGL01937:Hipk1 APN 3 103744004 missense possibly damaging 0.71
IGL01945:Hipk1 APN 3 103744004 missense possibly damaging 0.71
IGL02184:Hipk1 APN 3 103758750 missense possibly damaging 0.96
IGL02430:Hipk1 APN 3 103760655 missense probably damaging 1.00
IGL02603:Hipk1 APN 3 103750272 missense probably damaging 0.97
IGL02632:Hipk1 APN 3 103760545 missense probably benign 0.14
IGL02686:Hipk1 APN 3 103778017 missense possibly damaging 0.82
IGL03293:Hipk1 APN 3 103777259 missense possibly damaging 0.83
effluvient UTSW 3 103754325 splice site probably null
R0012:Hipk1 UTSW 3 103763680 missense probably damaging 0.98
R0012:Hipk1 UTSW 3 103763680 missense probably damaging 0.98
R0512:Hipk1 UTSW 3 103760574 missense possibly damaging 0.95
R0741:Hipk1 UTSW 3 103746812 missense probably benign 0.17
R0785:Hipk1 UTSW 3 103754325 splice site probably null
R0786:Hipk1 UTSW 3 103744304 missense probably benign
R0833:Hipk1 UTSW 3 103754296 missense probably damaging 0.98
R0836:Hipk1 UTSW 3 103754296 missense probably damaging 0.98
R1165:Hipk1 UTSW 3 103761524 missense possibly damaging 0.62
R1322:Hipk1 UTSW 3 103743981 missense probably damaging 1.00
R1384:Hipk1 UTSW 3 103758774 splice site probably benign
R1521:Hipk1 UTSW 3 103777782 missense probably benign 0.16
R1543:Hipk1 UTSW 3 103778164 missense probably benign 0.00
R2085:Hipk1 UTSW 3 103750354 missense probably benign 0.00
R2158:Hipk1 UTSW 3 103760538 missense probably damaging 1.00
R2291:Hipk1 UTSW 3 103761610 missense probably damaging 1.00
R3522:Hipk1 UTSW 3 103744114 missense probably damaging 0.96
R4516:Hipk1 UTSW 3 103750372 missense probably damaging 0.98
R4518:Hipk1 UTSW 3 103750372 missense probably damaging 0.98
R4884:Hipk1 UTSW 3 103744022 missense possibly damaging 0.47
R5023:Hipk1 UTSW 3 103777507 missense probably damaging 1.00
R6045:Hipk1 UTSW 3 103746902 missense probably benign 0.45
R6641:Hipk1 UTSW 3 103753405 missense probably damaging 0.99
R6904:Hipk1 UTSW 3 103777512 missense possibly damaging 0.90
R6925:Hipk1 UTSW 3 103778245 missense unknown
R7169:Hipk1 UTSW 3 103744217 missense probably benign
R7212:Hipk1 UTSW 3 103777610 nonsense probably null
R7313:Hipk1 UTSW 3 103778258 missense unknown
R7678:Hipk1 UTSW 3 103760550 missense probably damaging 0.98
R8133:Hipk1 UTSW 3 103753394 missense possibly damaging 0.83
R8154:Hipk1 UTSW 3 103749336 missense probably damaging 1.00
Z1088:Hipk1 UTSW 3 103764544 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAAGAAACGTTGCTCCTGTGAG -3'
(R):5'- CTGTTGGTGAGCTTCGCATC -3'

Sequencing Primer
(F):5'- AGTCAGGGTCTGGCTGC -3'
(R):5'- TGAGCTTCGCATCGTGAGC -3'
Posted On2020-07-13