Mutagenetix > Incidental Mutation

Incidental Mutation 'R8166:N4bp2'

633768

Institutional Source

Beutler Lab

Gene Symbol

N4bp2

Ensembl Gene

ENSMUSG00000037795

Gene Name

NEDD4 binding protein 2

Synonyms

B3bp, LOC333789, LOC386488

MMRRC Submission

Accession Numbers

Genbank: NM_001024917.1; Ensembl: ENSMUST00000113738

Essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R8166 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65763521-65830108 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 65820312 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 1518 (S1518A)

Ref Sequence

ENSEMBL: ENSMUSP00000084519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087264] [ENSMUST00000201489] [ENSMUST00000201615]

AlphaFold

F8VQG7

Predicted Effect

probably benign
Transcript: ENSMUST00000087264
AA Change: S1518A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000084519
Gene: ENSMUSG00000037795
AA Change: S1518A

Domain	Start	End	E-Value	Type
low complexity region	109	130	N/A	INTRINSIC
low complexity region	271	283	N/A	INTRINSIC
Pfam:AAA_33	365	499	1.1e-15	PFAM
low complexity region	533	546	N/A	INTRINSIC
low complexity region	619	629	N/A	INTRINSIC
low complexity region	681	692	N/A	INTRINSIC
low complexity region	847	864	N/A	INTRINSIC
low complexity region	1079	1090	N/A	INTRINSIC
Blast:CUE	1430	1472	1e-9	BLAST
low complexity region	1496	1511	N/A	INTRINSIC
DUF1771	1526	1591	1.88e-21	SMART
SMR	1596	1678	1.09e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201489
AA Change: S1518A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000143807
Gene: ENSMUSG00000037795
AA Change: S1518A

Domain	Start	End	E-Value	Type
low complexity region	109	130	N/A	INTRINSIC
low complexity region	271	283	N/A	INTRINSIC
Pfam:AAA_33	365	499	1e-14	PFAM
low complexity region	533	546	N/A	INTRINSIC
low complexity region	619	629	N/A	INTRINSIC
low complexity region	681	692	N/A	INTRINSIC
low complexity region	847	864	N/A	INTRINSIC
low complexity region	1079	1090	N/A	INTRINSIC
Blast:CUE	1430	1472	1e-9	BLAST
low complexity region	1496	1511	N/A	INTRINSIC
DUF1771	1526	1591	1.88e-21	SMART
SMR	1596	1678	1.09e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201615

SMART Domains

Protein: ENSMUSP00000144278
Gene: ENSMUSG00000037795

Domain	Start	End	E-Value	Type
low complexity region	109	130	N/A	INTRINSIC
low complexity region	271	283	N/A	INTRINSIC
Pfam:AAA_33	365	499	1.2e-14	PFAM
low complexity region	533	546	N/A	INTRINSIC
low complexity region	619	629	N/A	INTRINSIC
low complexity region	681	692	N/A	INTRINSIC
low complexity region	847	864	N/A	INTRINSIC
low complexity region	1079	1090	N/A	INTRINSIC
Blast:CUE	1430	1472	8e-10	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a polynucleotide kinase domain (PNK) near the N-terminal region, and a Small MutS Related (Smr) domain near the C-terminal region. The encoded protein can bind to both B-cell leukemia/lymphoma 3 (BCL-3) and neural precursor cell expressed, developmentally downregulated 4, (Nedd4) proteins. This protein binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. This protein may play a role in transcription-coupled DNA repair or genetic recombination. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]

Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	A	T	13: 64,309,107	Y101N		Het
Acad9	T	C	3: 36,090,083	V569A	probably benign	Het
Actrt3	A	G	3: 30,598,525	F140S	probably damaging	Het
Alx1	T	A	10: 103,009,363	Q269L	probably damaging	Het
Amph	G	T	13: 18,948,490	A20S	possibly damaging	Het
Aqr	T	A	2: 114,113,325	M1111L	possibly damaging	Het
Atp10a	A	T	7: 58,807,522	H923L	possibly damaging	Het
Bmpr1a	A	C	14: 34,425,069	W249G	probably damaging	Het
Bmpr2	A	T	1: 59,867,581	N611I	probably damaging	Het
Cadm2	A	G	16: 66,953,309	L9S	probably benign	Het
Ccdc102a	C	A	8: 94,913,316	A117S	possibly damaging	Het
Clec4f	G	T	6: 83,652,642	S311R	possibly damaging	Het
Dchs2	T	A	3: 83,354,333	I2636N	probably benign	Het
Dync2h1	T	A	9: 7,129,089	K1809*	probably null	Het
Efs	C	T	14: 54,920,620	R108Q	probably damaging	Het
Eif5b	A	G	1: 38,048,820	T966A	probably benign	Het
Fam189a1	A	G	7: 64,759,405	S414P	probably benign	Het
Flnc	A	C	6: 29,433,732	N92H	probably damaging	Het
Gm13030	A	T	4: 138,871,222	L130H	unknown	Het
Gm17190	A	C	13: 96,082,634	R159S	unknown	Het
Hipk1	T	C	3: 103,778,173	Y42C	possibly damaging	Het
Ifi207	C	A	1: 173,729,600	C524F	possibly damaging	Het
Ifi207	A	C	1: 173,729,938	S411R	probably benign	Het
Ighv8-9	G	T	12: 115,468,592	P33H	probably damaging	Het
Igkv8-34	A	G	6: 70,044,635	V15A	probably benign	Het
Irx5	T	A	8: 92,360,084		probably null	Het
Kcnh4	A	G	11: 100,741,886	L925P	probably benign	Het
Kctd9	G	A	14: 67,729,692	R153H	possibly damaging	Het
Lats1	A	G	10: 7,702,116	T335A	probably benign	Het
Med20	A	G	17: 47,613,102	T52A	probably benign	Het
Msantd4	A	T	9: 4,384,095	T139S	possibly damaging	Het
Mtif3	T	C	5: 146,959,242	T12A	probably benign	Het
Naip2	T	C	13: 100,162,007	N507S	probably benign	Het
Nasp	A	T	4: 116,610,915	V291E	probably benign	Het
Ncapg2	T	G	12: 116,412,416	D40E	probably benign	Het
Nipsnap1	A	G	11: 4,884,057	D103G	probably benign	Het
Nsmce1	A	G	7: 125,471,147	L164P	probably damaging	Het
Ogdhl	G	A	14: 32,337,806	V426I	probably damaging	Het
Olfr490	A	G	7: 108,286,697	V143A	probably benign	Het
P3h2	T	C	16: 25,992,822	E217G	possibly damaging	Het
Pnpt1	A	G	11: 29,156,875	I649V	probably benign	Het
Pum2	G	A	12: 8,721,739	A361T	possibly damaging	Het
Rictor	G	A	15: 6,769,334		probably null	Het
Rps6ka4	G	A	19: 6,837,443	R264W	possibly damaging	Het
Rsf1	G	GACGGCGGCA	7: 97,579,909		probably benign	Het
Sall1	T	C	8: 89,028,518	T1278A	probably benign	Het
Scg2	T	A	1: 79,435,583	K434N	possibly damaging	Het
Suclg1	T	A	6: 73,260,572	V100D	probably damaging	Het
Tarbp1	T	G	8: 126,427,128	E1528D	possibly damaging	Het
Tcrg-C1	A	G	13: 19,216,602	N167S		Het
Tshz2	C	A	2: 169,883,655	T57K	probably benign	Het
Ttc22	G	A	4: 106,634,476	R229H	probably damaging	Het
Vcan	A	G	13: 89,692,736	V1563A	probably benign	Het
Vmn1r68	A	T	7: 10,527,961	M70K	probably benign	Het
Vmn2r105	A	T	17: 20,208,642	I724N	probably benign	Het
Vmn2r96	T	C	17: 18,582,482	L26P	probably damaging	Het
Wdr72	G	A	9: 74,213,328	S955N	probably benign	Het
Zfp518b	C	A	5: 38,674,495	A56S	probably damaging	Het

Other mutations in N4bp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:N4bp2	APN	5	65807524	missense	probably damaging	0.96
IGL01503:N4bp2	APN	5	65803547	nonsense	probably null	0.00
IGL01621:N4bp2	APN	5	65790924	missense	probably damaging	1.00
IGL02109:N4bp2	APN	5	65798134	missense	probably damaging	1.00
IGL02286:N4bp2	APN	5	65803552	missense	probably damaging	1.00
1mM(1):N4bp2	UTSW	5	65807677	missense	probably damaging	1.00
IGL03046:N4bp2	UTSW	5	65790960	missense	probably damaging	1.00
R0164:N4bp2	UTSW	5	65803573	splice site	probably benign
R0285:N4bp2	UTSW	5	65806559	missense	probably benign	0.00
R0366:N4bp2	UTSW	5	65806396	missense	possibly damaging	0.95
R0548:N4bp2	UTSW	5	65808153	missense	probably benign	0.39
R0551:N4bp2	UTSW	5	65820341	splice site	probably null
R0671:N4bp2	UTSW	5	65807437	missense	probably damaging	0.99
R1136:N4bp2	UTSW	5	65808472	missense	probably damaging	1.00
R1515:N4bp2	UTSW	5	65790498	missense	probably benign	0.01
R1597:N4bp2	UTSW	5	65807140	missense	probably benign	0.45
R1628:N4bp2	UTSW	5	65803572	splice site	probably null
R1722:N4bp2	UTSW	5	65806882	missense	probably benign	0.08
R1735:N4bp2	UTSW	5	65808316	missense	probably damaging	1.00
R1745:N4bp2	UTSW	5	65790822	missense	probably benign	0.12
R1759:N4bp2	UTSW	5	65826613	missense	probably damaging	1.00
R1799:N4bp2	UTSW	5	65806825	missense	possibly damaging	0.62
R1846:N4bp2	UTSW	5	65808519	missense	probably damaging	1.00
R1872:N4bp2	UTSW	5	65794518	splice site	probably benign
R2042:N4bp2	UTSW	5	65826621	missense	probably damaging	1.00
R2082:N4bp2	UTSW	5	65807565	missense	probably damaging	1.00
R2101:N4bp2	UTSW	5	65790881	missense	probably damaging	1.00
R2147:N4bp2	UTSW	5	65809200	missense	probably damaging	1.00
R2251:N4bp2	UTSW	5	65806728	missense	probably damaging	1.00
R2507:N4bp2	UTSW	5	65790061	missense	probably benign	0.01
R2508:N4bp2	UTSW	5	65790061	missense	probably benign	0.01
R2919:N4bp2	UTSW	5	65807098	missense	probably benign	0.22
R3086:N4bp2	UTSW	5	65791053	missense	probably damaging	1.00
R4092:N4bp2	UTSW	5	65790456	missense	probably benign	0.02
R4177:N4bp2	UTSW	5	65798170	splice site	probably null
R4718:N4bp2	UTSW	5	65803463	missense	probably damaging	1.00
R4859:N4bp2	UTSW	5	65825298	missense	probably damaging	1.00
R4863:N4bp2	UTSW	5	65808130	missense	probably benign	0.22
R4915:N4bp2	UTSW	5	65803504	missense	probably damaging	1.00
R4949:N4bp2	UTSW	5	65821799	splice site	probably null
R4978:N4bp2	UTSW	5	65790240	missense	probably damaging	1.00
R5029:N4bp2	UTSW	5	65814780	missense	probably damaging	1.00
R5079:N4bp2	UTSW	5	65811977	missense	probably damaging	1.00
R5097:N4bp2	UTSW	5	65817218	missense	probably damaging	1.00
R5158:N4bp2	UTSW	5	65808462	missense	probably damaging	0.99
R5228:N4bp2	UTSW	5	65807518	missense	probably benign
R5322:N4bp2	UTSW	5	65790457	missense	possibly damaging	0.76
R5554:N4bp2	UTSW	5	65808114	missense	probably benign	0.44
R5731:N4bp2	UTSW	5	65809157	missense	probably damaging	1.00
R5840:N4bp2	UTSW	5	65808094	missense	probably damaging	0.99
R6393:N4bp2	UTSW	5	65791001	missense	possibly damaging	0.81
R6767:N4bp2	UTSW	5	65817187	missense	probably damaging	1.00
R7103:N4bp2	UTSW	5	65806846	missense	probably benign	0.01
R7112:N4bp2	UTSW	5	65790707	missense	possibly damaging	0.74
R7171:N4bp2	UTSW	5	65808022	missense	probably benign	0.00
R7177:N4bp2	UTSW	5	65807548	missense	probably damaging	1.00
R7240:N4bp2	UTSW	5	65794545	missense	probably damaging	0.96
R7353:N4bp2	UTSW	5	65806371	missense	probably benign	0.01
R7450:N4bp2	UTSW	5	65825300	nonsense	probably null
R7560:N4bp2	UTSW	5	65791115	missense	probably damaging	0.99
R7698:N4bp2	UTSW	5	65808157	missense	probably benign	0.00
R7743:N4bp2	UTSW	5	65808459	missense	probably damaging	1.00
R7871:N4bp2	UTSW	5	65807103	missense	probably benign	0.00
R7981:N4bp2	UTSW	5	65812142	missense	probably benign	0.41
R8065:N4bp2	UTSW	5	65807296	missense	probably damaging	0.99
R8067:N4bp2	UTSW	5	65807296	missense	probably damaging	0.99
R8164:N4bp2	UTSW	5	65809223	missense	probably damaging	1.00
R8331:N4bp2	UTSW	5	65807600	missense	probably damaging	1.00
R8559:N4bp2	UTSW	5	65825285	missense	possibly damaging	0.62
R8806:N4bp2	UTSW	5	65808208	missense	possibly damaging	0.63
R9287:N4bp2	UTSW	5	65803512	missense	probably benign	0.38
R9369:N4bp2	UTSW	5	65806916	missense	probably damaging	0.97
R9460:N4bp2	UTSW	5	65806543	missense	probably benign	0.00
R9462:N4bp2	UTSW	5	65790555	missense	probably benign	0.02
R9605:N4bp2	UTSW	5	65806536	missense	probably benign	0.02
R9641:N4bp2	UTSW	5	65790692	missense	probably benign	0.15
Z1177:N4bp2	UTSW	5	65807637	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGAACACATCCAGTTGCCTC -3'
(R):5'- GAACGAACTGTAACCGGTTTTCC -3'

Sequencing Primer
(F):5'- ACCTTCCTGCTTTTGTATGATAGC -3'
(R):5'- CGCTTCACCTGCTGAGC -3'

Posted On

2020-07-13