Incidental Mutation 'R8166:Flnc'
ID633771
Institutional Source Beutler Lab
Gene Symbol Flnc
Ensembl Gene ENSMUSG00000068699
Gene Namefilamin C, gamma
Synonyms1110055E19Rik, actin binding protein 280, Fln2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8166 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location29433256-29461883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 29433732 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 92 (N92H)
Ref Sequence ENSEMBL: ENSMUSP00000064163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065090] [ENSMUST00000101617]
Predicted Effect probably damaging
Transcript: ENSMUST00000065090
AA Change: N92H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064163
Gene: ENSMUSG00000068699
AA Change: N92H

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 1.05e-30 SMART
IG_FLMN 1777 1858 2.93e-11 SMART
IG_FLMN 1859 1950 2.55e-43 SMART
IG_FLMN 1951 2037 2.43e-17 SMART
IG_FLMN 2041 2132 1.52e-41 SMART
PDB:2E9I|A 2133 2162 3e-7 PDB
IG_FLMN 2217 2310 2.93e-11 SMART
IG_FLMN 2314 2405 1.67e-38 SMART
IG_FLMN 2408 2500 2.56e-25 SMART
IG_FLMN 2505 2596 9.54e-34 SMART
low complexity region 2618 2628 N/A INTRINSIC
IG_FLMN 2635 2737 2.11e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101617
AA Change: N92H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099139
Gene: ENSMUSG00000068699
AA Change: N92H

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 6.11e-32 SMART
IG_FLMN 1744 1825 2.93e-11 SMART
IG_FLMN 1826 1917 2.55e-43 SMART
IG_FLMN 1918 2004 2.43e-17 SMART
IG_FLMN 2008 2099 1.52e-41 SMART
PDB:2E9I|A 2100 2129 3e-7 PDB
IG_FLMN 2184 2277 2.93e-11 SMART
IG_FLMN 2281 2372 1.67e-38 SMART
IG_FLMN 2375 2467 2.56e-25 SMART
IG_FLMN 2472 2563 9.54e-34 SMART
low complexity region 2585 2595 N/A INTRINSIC
IG_FLMN 2602 2704 2.11e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display neonatal lethality, respiratory failure, reduced skeletal muscle mass, and abnormal skeletal muscle fiber morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,309,107 Y101N Het
Acad9 T C 3: 36,090,083 V569A probably benign Het
Actrt3 A G 3: 30,598,525 F140S probably damaging Het
AI607873 C A 1: 173,729,600 C524F possibly damaging Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Alx1 T A 10: 103,009,363 Q269L probably damaging Het
Amph G T 13: 18,948,490 A20S possibly damaging Het
Aqr T A 2: 114,113,325 M1111L possibly damaging Het
Atp10a A T 7: 58,807,522 H923L possibly damaging Het
Bmpr1a A C 14: 34,425,069 W249G probably damaging Het
Bmpr2 A T 1: 59,867,581 N611I probably damaging Het
Cadm2 A G 16: 66,953,309 L9S probably benign Het
Ccdc102a C A 8: 94,913,316 A117S possibly damaging Het
Clec4f G T 6: 83,652,642 S311R possibly damaging Het
Dchs2 T A 3: 83,354,333 I2636N probably benign Het
Dync2h1 T A 9: 7,129,089 K1809* probably null Het
Efs C T 14: 54,920,620 R108Q probably damaging Het
Eif5b A G 1: 38,048,820 T966A probably benign Het
Fam189a1 A G 7: 64,759,405 S414P probably benign Het
Gm13030 A T 4: 138,871,222 L130H unknown Het
Gm17190 A C 13: 96,082,634 R159S unknown Het
Hipk1 T C 3: 103,778,173 Y42C possibly damaging Het
Ighv8-9 G T 12: 115,468,592 P33H probably damaging Het
Igkv8-34 A G 6: 70,044,635 V15A probably benign Het
Irx5 T A 8: 92,360,084 probably null Het
Kcnh4 A G 11: 100,741,886 L925P probably benign Het
Kctd9 G A 14: 67,729,692 R153H possibly damaging Het
Lats1 A G 10: 7,702,116 T335A probably benign Het
Med20 A G 17: 47,613,102 T52A probably benign Het
Msantd4 A T 9: 4,384,095 T139S possibly damaging Het
Mtif3 T C 5: 146,959,242 T12A probably benign Het
N4bp2 T G 5: 65,820,312 S1518A probably benign Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nasp A T 4: 116,610,915 V291E probably benign Het
Ncapg2 T G 12: 116,412,416 D40E probably benign Het
Nipsnap1 A G 11: 4,884,057 D103G probably benign Het
Nsmce1 A G 7: 125,471,147 L164P probably damaging Het
Ogdhl G A 14: 32,337,806 V426I probably damaging Het
Olfr490 A G 7: 108,286,697 V143A probably benign Het
P3h2 T C 16: 25,992,822 E217G possibly damaging Het
Pnpt1 A G 11: 29,156,875 I649V probably benign Het
Pum2 G A 12: 8,721,739 A361T possibly damaging Het
Rictor G A 15: 6,769,334 probably null Het
Rps6ka4 G A 19: 6,837,443 R264W possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall1 T C 8: 89,028,518 T1278A probably benign Het
Scg2 T A 1: 79,435,583 K434N possibly damaging Het
Suclg1 T A 6: 73,260,572 V100D probably damaging Het
Tarbp1 T G 8: 126,427,128 E1528D possibly damaging Het
Tcrg-C1 A G 13: 19,216,602 N167S Het
Tshz2 C A 2: 169,883,655 T57K probably benign Het
Ttc22 G A 4: 106,634,476 R229H probably damaging Het
Vcan A G 13: 89,692,736 V1563A probably benign Het
Vmn1r68 A T 7: 10,527,961 M70K probably benign Het
Vmn2r105 A T 17: 20,208,642 I724N probably benign Het
Vmn2r96 T C 17: 18,582,482 L26P probably damaging Het
Wdr72 G A 9: 74,213,328 S955N probably benign Het
Zfp518b C A 5: 38,674,495 A56S probably damaging Het
Other mutations in Flnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Flnc APN 6 29459547 nonsense probably null
IGL01099:Flnc APN 6 29433618 missense probably damaging 0.99
IGL01656:Flnc APN 6 29443508 splice site probably benign
IGL01659:Flnc APN 6 29448671 missense probably damaging 0.98
IGL01780:Flnc APN 6 29438493 nonsense probably null
IGL01935:Flnc APN 6 29454280 missense probably damaging 1.00
IGL02039:Flnc APN 6 29450719 missense probably benign 0.05
IGL02119:Flnc APN 6 29447512 missense probably damaging 0.98
IGL02122:Flnc APN 6 29444336 missense possibly damaging 0.70
IGL02236:Flnc APN 6 29454376 missense probably damaging 1.00
IGL02350:Flnc APN 6 29438493 nonsense probably null
IGL02357:Flnc APN 6 29438493 nonsense probably null
IGL02428:Flnc APN 6 29451485 missense probably damaging 1.00
IGL02496:Flnc APN 6 29440685 missense probably damaging 0.98
IGL02516:Flnc APN 6 29450841 missense probably damaging 0.99
IGL02696:Flnc APN 6 29446698 missense probably damaging 0.98
IGL03165:Flnc APN 6 29449378 missense probably damaging 1.00
IGL03190:Flnc APN 6 29445637 splice site probably benign
I1329:Flnc UTSW 6 29451415 missense probably damaging 1.00
R0111:Flnc UTSW 6 29454340 missense probably damaging 0.99
R0665:Flnc UTSW 6 29455531 missense probably damaging 1.00
R0748:Flnc UTSW 6 29446344 missense probably damaging 0.99
R0960:Flnc UTSW 6 29441512 missense probably damaging 1.00
R1328:Flnc UTSW 6 29438613 missense probably damaging 1.00
R1502:Flnc UTSW 6 29438694 missense probably benign 0.45
R1544:Flnc UTSW 6 29444080 missense probably benign 0.00
R1565:Flnc UTSW 6 29455171 missense probably damaging 1.00
R1640:Flnc UTSW 6 29433807 missense possibly damaging 0.78
R1691:Flnc UTSW 6 29441214 missense probably benign 0.09
R1818:Flnc UTSW 6 29457448 missense probably damaging 1.00
R1826:Flnc UTSW 6 29455185 missense probably damaging 0.99
R1851:Flnc UTSW 6 29443479 missense probably damaging 1.00
R1898:Flnc UTSW 6 29438666 nonsense probably null
R1905:Flnc UTSW 6 29459460 missense probably damaging 1.00
R1985:Flnc UTSW 6 29444416 splice site probably benign
R2016:Flnc UTSW 6 29443797 critical splice donor site probably null
R2017:Flnc UTSW 6 29443797 critical splice donor site probably null
R2020:Flnc UTSW 6 29444363 missense probably damaging 0.97
R2104:Flnc UTSW 6 29450735 critical splice donor site probably null
R2132:Flnc UTSW 6 29443676 missense probably damaging 1.00
R2141:Flnc UTSW 6 29448675 missense probably damaging 1.00
R2197:Flnc UTSW 6 29459135 missense probably damaging 1.00
R2202:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2203:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2204:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2205:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2209:Flnc UTSW 6 29455845 missense possibly damaging 0.91
R2248:Flnc UTSW 6 29451401 missense probably damaging 0.99
R2258:Flnc UTSW 6 29438666 nonsense probably null
R2259:Flnc UTSW 6 29438666 nonsense probably null
R2280:Flnc UTSW 6 29438666 nonsense probably null
R2281:Flnc UTSW 6 29438666 nonsense probably null
R2873:Flnc UTSW 6 29447543 missense probably damaging 0.96
R2900:Flnc UTSW 6 29448585 missense probably damaging 0.98
R3788:Flnc UTSW 6 29454057 missense probably damaging 0.99
R3799:Flnc UTSW 6 29443739 missense probably damaging 1.00
R3801:Flnc UTSW 6 29447404 missense probably damaging 0.98
R3851:Flnc UTSW 6 29453719 missense probably damaging 1.00
R3910:Flnc UTSW 6 29459427 missense probably damaging 1.00
R3982:Flnc UTSW 6 29442941 missense probably damaging 1.00
R3983:Flnc UTSW 6 29442941 missense probably damaging 1.00
R4023:Flnc UTSW 6 29451635 missense possibly damaging 0.95
R4676:Flnc UTSW 6 29445154 splice site probably null
R4694:Flnc UTSW 6 29443448 missense probably damaging 1.00
R4695:Flnc UTSW 6 29440429 missense probably damaging 0.99
R4735:Flnc UTSW 6 29455813 missense probably damaging 1.00
R4773:Flnc UTSW 6 29445039 missense possibly damaging 0.96
R4828:Flnc UTSW 6 29455167 missense probably damaging 1.00
R4856:Flnc UTSW 6 29447890 missense probably damaging 1.00
R4879:Flnc UTSW 6 29460806 missense probably damaging 0.99
R4899:Flnc UTSW 6 29446843 missense probably benign 0.17
R4906:Flnc UTSW 6 29447525 missense probably damaging 0.99
R5089:Flnc UTSW 6 29447813 missense probably damaging 0.96
R5173:Flnc UTSW 6 29455538 missense probably damaging 1.00
R5174:Flnc UTSW 6 29448894 missense possibly damaging 0.91
R5290:Flnc UTSW 6 29457554 missense probably damaging 1.00
R5338:Flnc UTSW 6 29444064 missense possibly damaging 0.47
R5352:Flnc UTSW 6 29449318 missense possibly damaging 0.85
R5397:Flnc UTSW 6 29441161 missense possibly damaging 0.87
R5431:Flnc UTSW 6 29456384 missense possibly damaging 0.74
R5481:Flnc UTSW 6 29441217 missense probably damaging 1.00
R5511:Flnc UTSW 6 29458898 missense probably damaging 1.00
R5539:Flnc UTSW 6 29446230 missense probably damaging 1.00
R5549:Flnc UTSW 6 29453691 missense probably damaging 1.00
R5567:Flnc UTSW 6 29444045 nonsense probably null
R5584:Flnc UTSW 6 29446628 missense probably damaging 0.98
R5689:Flnc UTSW 6 29441592 missense probably benign 0.03
R5753:Flnc UTSW 6 29433489 missense probably benign
R5786:Flnc UTSW 6 29459537 nonsense probably null
R5822:Flnc UTSW 6 29459430 missense probably damaging 0.98
R5823:Flnc UTSW 6 29461202 missense probably damaging 0.99
R5933:Flnc UTSW 6 29441106 missense probably damaging 0.99
R6043:Flnc UTSW 6 29446608 missense probably damaging 1.00
R6320:Flnc UTSW 6 29459063 missense probably damaging 1.00
R6337:Flnc UTSW 6 29454319 missense probably damaging 0.99
R6399:Flnc UTSW 6 29458883 missense probably damaging 1.00
R6423:Flnc UTSW 6 29445156 splice site probably null
R6540:Flnc UTSW 6 29446377 missense possibly damaging 0.96
R6547:Flnc UTSW 6 29448608 missense probably damaging 0.98
R6717:Flnc UTSW 6 29450902 small deletion probably benign
R6875:Flnc UTSW 6 29445749 missense probably damaging 1.00
R7193:Flnc UTSW 6 29450871 missense probably damaging 1.00
R7255:Flnc UTSW 6 29445766 missense probably damaging 1.00
R7303:Flnc UTSW 6 29460850 missense probably benign 0.31
R7413:Flnc UTSW 6 29452259 missense probably damaging 1.00
R7422:Flnc UTSW 6 29455471 missense probably damaging 1.00
R7559:Flnc UTSW 6 29459010 missense probably damaging 1.00
R7632:Flnc UTSW 6 29446985 missense probably damaging 0.98
R7651:Flnc UTSW 6 29444050 missense probably benign 0.08
R7679:Flnc UTSW 6 29456790 missense probably benign 0.00
R7697:Flnc UTSW 6 29456517 missense probably damaging 0.98
R7788:Flnc UTSW 6 29456444 missense possibly damaging 0.67
R7852:Flnc UTSW 6 29440898 missense probably damaging 1.00
R7870:Flnc UTSW 6 29454307 missense probably damaging 1.00
R7873:Flnc UTSW 6 29456991 missense possibly damaging 0.88
R7921:Flnc UTSW 6 29447770 missense possibly damaging 0.58
R7950:Flnc UTSW 6 29456382 missense possibly damaging 0.61
R7953:Flnc UTSW 6 29447829 missense probably damaging 0.99
R7970:Flnc UTSW 6 29447526 missense possibly damaging 0.96
R8071:Flnc UTSW 6 29457446 missense probably damaging 1.00
R8143:Flnc UTSW 6 29441485 missense probably benign 0.20
R8167:Flnc UTSW 6 29455922 missense probably damaging 0.98
R8306:Flnc UTSW 6 29449370 missense probably benign 0.05
R8428:Flnc UTSW 6 29450850 missense probably benign 0.36
Z1088:Flnc UTSW 6 29457151 missense probably damaging 1.00
Z1177:Flnc UTSW 6 29447545 missense probably damaging 1.00
Z1177:Flnc UTSW 6 29457130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCAACTATTCGGACGCC -3'
(R):5'- AAGGTTTTCTGTTCCGGATCTCAG -3'

Sequencing Primer
(F):5'- TCCACGGAGAAGGACCTAGC -3'
(R):5'- GGATCTCAGTACCCGCACCTATG -3'
Posted On2020-07-13