Incidental Mutation 'R8166:Vmn1r68'
ID633775
Institutional Source Beutler Lab
Gene Symbol Vmn1r68
Ensembl Gene ENSMUSG00000047031
Gene Namevomeronasal 1 receptor 68
SynonymsGm6898
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8166 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location10527210-10528169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10527961 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 70 (M70K)
Ref Sequence ENSEMBL: ENSMUSP00000050927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058362]
Predicted Effect probably benign
Transcript: ENSMUST00000058362
AA Change: M70K

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000050927
Gene: ENSMUSG00000047031
AA Change: M70K

DomainStartEndE-ValueType
Pfam:V1R 49 306 2e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,309,107 Y101N Het
Acad9 T C 3: 36,090,083 V569A probably benign Het
Actrt3 A G 3: 30,598,525 F140S probably damaging Het
AI607873 C A 1: 173,729,600 C524F possibly damaging Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Alx1 T A 10: 103,009,363 Q269L probably damaging Het
Amph G T 13: 18,948,490 A20S possibly damaging Het
Aqr T A 2: 114,113,325 M1111L possibly damaging Het
Atp10a A T 7: 58,807,522 H923L possibly damaging Het
Bmpr1a A C 14: 34,425,069 W249G probably damaging Het
Bmpr2 A T 1: 59,867,581 N611I probably damaging Het
Cadm2 A G 16: 66,953,309 L9S probably benign Het
Ccdc102a C A 8: 94,913,316 A117S possibly damaging Het
Clec4f G T 6: 83,652,642 S311R possibly damaging Het
Dchs2 T A 3: 83,354,333 I2636N probably benign Het
Dync2h1 T A 9: 7,129,089 K1809* probably null Het
Efs C T 14: 54,920,620 R108Q probably damaging Het
Eif5b A G 1: 38,048,820 T966A probably benign Het
Fam189a1 A G 7: 64,759,405 S414P probably benign Het
Flnc A C 6: 29,433,732 N92H probably damaging Het
Gm13030 A T 4: 138,871,222 L130H unknown Het
Gm17190 A C 13: 96,082,634 R159S unknown Het
Hipk1 T C 3: 103,778,173 Y42C possibly damaging Het
Ighv8-9 G T 12: 115,468,592 P33H probably damaging Het
Igkv8-34 A G 6: 70,044,635 V15A probably benign Het
Irx5 T A 8: 92,360,084 probably null Het
Kcnh4 A G 11: 100,741,886 L925P probably benign Het
Kctd9 G A 14: 67,729,692 R153H possibly damaging Het
Lats1 A G 10: 7,702,116 T335A probably benign Het
Med20 A G 17: 47,613,102 T52A probably benign Het
Msantd4 A T 9: 4,384,095 T139S possibly damaging Het
Mtif3 T C 5: 146,959,242 T12A probably benign Het
N4bp2 T G 5: 65,820,312 S1518A probably benign Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nasp A T 4: 116,610,915 V291E probably benign Het
Ncapg2 T G 12: 116,412,416 D40E probably benign Het
Nipsnap1 A G 11: 4,884,057 D103G probably benign Het
Nsmce1 A G 7: 125,471,147 L164P probably damaging Het
Ogdhl G A 14: 32,337,806 V426I probably damaging Het
Olfr490 A G 7: 108,286,697 V143A probably benign Het
P3h2 T C 16: 25,992,822 E217G possibly damaging Het
Pnpt1 A G 11: 29,156,875 I649V probably benign Het
Pum2 G A 12: 8,721,739 A361T possibly damaging Het
Rictor G A 15: 6,769,334 probably null Het
Rps6ka4 G A 19: 6,837,443 R264W possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall1 T C 8: 89,028,518 T1278A probably benign Het
Scg2 T A 1: 79,435,583 K434N possibly damaging Het
Suclg1 T A 6: 73,260,572 V100D probably damaging Het
Tarbp1 T G 8: 126,427,128 E1528D possibly damaging Het
Tcrg-C1 A G 13: 19,216,602 N167S Het
Tshz2 C A 2: 169,883,655 T57K probably benign Het
Ttc22 G A 4: 106,634,476 R229H probably damaging Het
Vcan A G 13: 89,692,736 V1563A probably benign Het
Vmn2r105 A T 17: 20,208,642 I724N probably benign Het
Vmn2r96 T C 17: 18,582,482 L26P probably damaging Het
Wdr72 G A 9: 74,213,328 S955N probably benign Het
Zfp518b C A 5: 38,674,495 A56S probably damaging Het
Other mutations in Vmn1r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Vmn1r68 APN 7 10527407 missense possibly damaging 0.76
IGL02051:Vmn1r68 APN 7 10528021 missense probably benign 0.00
IGL02112:Vmn1r68 APN 7 10527860 missense probably damaging 0.96
IGL02619:Vmn1r68 APN 7 10527676 missense probably benign 0.14
IGL03033:Vmn1r68 APN 7 10528147 missense probably damaging 0.99
IGL03184:Vmn1r68 APN 7 10527872 missense probably benign 0.16
PIT4354001:Vmn1r68 UTSW 7 10528031 missense probably benign
R0141:Vmn1r68 UTSW 7 10527325 missense possibly damaging 0.69
R0359:Vmn1r68 UTSW 7 10527274 missense probably damaging 1.00
R0634:Vmn1r68 UTSW 7 10527235 missense probably benign 0.00
R1731:Vmn1r68 UTSW 7 10527875 missense probably damaging 1.00
R2021:Vmn1r68 UTSW 7 10527991 missense probably damaging 1.00
R2022:Vmn1r68 UTSW 7 10527991 missense probably damaging 1.00
R2243:Vmn1r68 UTSW 7 10528162 missense probably damaging 0.98
R2262:Vmn1r68 UTSW 7 10527445 missense probably damaging 1.00
R3877:Vmn1r68 UTSW 7 10527481 missense probably damaging 1.00
R4470:Vmn1r68 UTSW 7 10527348 missense probably benign 0.23
R4843:Vmn1r68 UTSW 7 10527977 missense probably benign 0.00
R5198:Vmn1r68 UTSW 7 10527796 missense probably benign 0.00
R5835:Vmn1r68 UTSW 7 10527820 missense possibly damaging 0.68
R5906:Vmn1r68 UTSW 7 10527623 missense probably benign 0.02
R6015:Vmn1r68 UTSW 7 10527689 missense probably benign 0.31
R7073:Vmn1r68 UTSW 7 10527851 missense probably benign 0.00
R7614:Vmn1r68 UTSW 7 10527626 missense probably benign 0.05
R7699:Vmn1r68 UTSW 7 10527632 missense probably benign 0.15
R7700:Vmn1r68 UTSW 7 10527632 missense probably benign 0.15
R7912:Vmn1r68 UTSW 7 10527310 missense probably benign 0.01
R8426:Vmn1r68 UTSW 7 10527455 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGAGTAGCCAATGTACTTTGAAG -3'
(R):5'- CCCAGTCGAAGATGGATTTCTG -3'

Sequencing Primer
(F):5'- TGACCCTTATAACAAGATACCCTATG -3'
(R):5'- AGTCGAAGATGGATTTCTGGAATATG -3'
Posted On2020-07-13