Mutagenetix > Incidental Mutation

Incidental Mutation 'R8166:Lats1'

633786

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.847) question?

Stock #

R8166 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7702116 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 335 (T335A)

Ref Sequence

ENSEMBL: ENSMUSP00000132078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952]

AlphaFold

Q8BYR2

Predicted Effect

probably benign
Transcript: ENSMUST00000040043
AA Change: T335A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: T335A

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165952
AA Change: T335A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: T335A

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	A	T	13: 64,309,107	Y101N		Het
Acad9	T	C	3: 36,090,083	V569A	probably benign	Het
Actrt3	A	G	3: 30,598,525	F140S	probably damaging	Het
Alx1	T	A	10: 103,009,363	Q269L	probably damaging	Het
Amph	G	T	13: 18,948,490	A20S	possibly damaging	Het
Aqr	T	A	2: 114,113,325	M1111L	possibly damaging	Het
Atp10a	A	T	7: 58,807,522	H923L	possibly damaging	Het
Bmpr1a	A	C	14: 34,425,069	W249G	probably damaging	Het
Bmpr2	A	T	1: 59,867,581	N611I	probably damaging	Het
Cadm2	A	G	16: 66,953,309	L9S	probably benign	Het
Ccdc102a	C	A	8: 94,913,316	A117S	possibly damaging	Het
Clec4f	G	T	6: 83,652,642	S311R	possibly damaging	Het
Dchs2	T	A	3: 83,354,333	I2636N	probably benign	Het
Dync2h1	T	A	9: 7,129,089	K1809*	probably null	Het
Efs	C	T	14: 54,920,620	R108Q	probably damaging	Het
Eif5b	A	G	1: 38,048,820	T966A	probably benign	Het
Fam189a1	A	G	7: 64,759,405	S414P	probably benign	Het
Flnc	A	C	6: 29,433,732	N92H	probably damaging	Het
Gm13030	A	T	4: 138,871,222	L130H	unknown	Het
Gm17190	A	C	13: 96,082,634	R159S	unknown	Het
Hipk1	T	C	3: 103,778,173	Y42C	possibly damaging	Het
Ifi207	C	A	1: 173,729,600	C524F	possibly damaging	Het
Ifi207	A	C	1: 173,729,938	S411R	probably benign	Het
Ighv8-9	G	T	12: 115,468,592	P33H	probably damaging	Het
Igkv8-34	A	G	6: 70,044,635	V15A	probably benign	Het
Irx5	T	A	8: 92,360,084		probably null	Het
Kcnh4	A	G	11: 100,741,886	L925P	probably benign	Het
Kctd9	G	A	14: 67,729,692	R153H	possibly damaging	Het
Med20	A	G	17: 47,613,102	T52A	probably benign	Het
Msantd4	A	T	9: 4,384,095	T139S	possibly damaging	Het
Mtif3	T	C	5: 146,959,242	T12A	probably benign	Het
N4bp2	T	G	5: 65,820,312	S1518A	probably benign	Het
Naip2	T	C	13: 100,162,007	N507S	probably benign	Het
Nasp	A	T	4: 116,610,915	V291E	probably benign	Het
Ncapg2	T	G	12: 116,412,416	D40E	probably benign	Het
Nipsnap1	A	G	11: 4,884,057	D103G	probably benign	Het
Nsmce1	A	G	7: 125,471,147	L164P	probably damaging	Het
Ogdhl	G	A	14: 32,337,806	V426I	probably damaging	Het
Olfr490	A	G	7: 108,286,697	V143A	probably benign	Het
P3h2	T	C	16: 25,992,822	E217G	possibly damaging	Het
Pnpt1	A	G	11: 29,156,875	I649V	probably benign	Het
Pum2	G	A	12: 8,721,739	A361T	possibly damaging	Het
Rictor	G	A	15: 6,769,334		probably null	Het
Rps6ka4	G	A	19: 6,837,443	R264W	possibly damaging	Het
Rsf1	G	GACGGCGGCA	7: 97,579,909		probably benign	Het
Sall1	T	C	8: 89,028,518	T1278A	probably benign	Het
Scg2	T	A	1: 79,435,583	K434N	possibly damaging	Het
Suclg1	T	A	6: 73,260,572	V100D	probably damaging	Het
Tarbp1	T	G	8: 126,427,128	E1528D	possibly damaging	Het
Tcrg-C1	A	G	13: 19,216,602	N167S		Het
Tshz2	C	A	2: 169,883,655	T57K	probably benign	Het
Ttc22	G	A	4: 106,634,476	R229H	probably damaging	Het
Vcan	A	G	13: 89,692,736	V1563A	probably benign	Het
Vmn1r68	A	T	7: 10,527,961	M70K	probably benign	Het
Vmn2r105	A	T	17: 20,208,642	I724N	probably benign	Het
Vmn2r96	T	C	17: 18,582,482	L26P	probably damaging	Het
Wdr72	G	A	9: 74,213,328	S955N	probably benign	Het
Zfp518b	C	A	5: 38,674,495	A56S	probably damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCTCAGACAAAGCGCTAC -3'
(R):5'- AACGTTTCCATTGGCGAATGATG -3'

Sequencing Primer
(F):5'- CGCTACTCTGGGAACATGGAGTAC -3'
(R):5'- GCAGCAGAAGCCCCTGTTTG -3'

Posted On

2020-07-13