Incidental Mutation 'R8166:Nipsnap1'
ID 633788
Institutional Source Beutler Lab
Gene Symbol Nipsnap1
Ensembl Gene ENSMUSG00000034285
Gene Name nipsnap homolog 1
Synonyms
MMRRC Submission 067592-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.319) question?
Stock # R8166 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 4823951-4844200 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4834057 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 103 (D103G)
Ref Sequence ENSEMBL: ENSMUSP00000049338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038570] [ENSMUST00000136552] [ENSMUST00000139737]
AlphaFold O55125
Predicted Effect probably benign
Transcript: ENSMUST00000038570
AA Change: D103G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000049338
Gene: ENSMUSG00000034285
AA Change: D103G

DomainStartEndE-ValueType
Pfam:NIPSNAP 185 282 2.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136552
Predicted Effect probably benign
Transcript: ENSMUST00000139737
AA Change: D82G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NipSnap family of proteins that may be involved in vesicular transport. A similar protein in mice inhibits the calcium channel TRPV6, and is also localized to the inner mitochondrial membrane where it may play a role in mitochondrial DNA maintenance. A pseudogene of this gene is located on the short arm of chromosome 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele treated with nocistatin fail to exhibit suppression of neuropeptide nociceptin/orphanin FQ-induced tactile allodynia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,144,232 (GRCm39) V569A probably benign Het
Actrt3 A G 3: 30,652,674 (GRCm39) F140S probably damaging Het
Alx1 T A 10: 102,845,224 (GRCm39) Q269L probably damaging Het
Amph G T 13: 19,132,660 (GRCm39) A20S possibly damaging Het
Aqr T A 2: 113,943,806 (GRCm39) M1111L possibly damaging Het
Atp10a A T 7: 58,457,270 (GRCm39) H923L possibly damaging Het
Bmpr1a A C 14: 34,147,026 (GRCm39) W249G probably damaging Het
Bmpr2 A T 1: 59,906,740 (GRCm39) N611I probably damaging Het
Cadm2 A G 16: 66,750,197 (GRCm39) L9S probably benign Het
Ccdc102a C A 8: 95,639,944 (GRCm39) A117S possibly damaging Het
Clec4f G T 6: 83,629,624 (GRCm39) S311R possibly damaging Het
Dchs2 T A 3: 83,261,640 (GRCm39) I2636N probably benign Het
Dync2h1 T A 9: 7,129,089 (GRCm39) K1809* probably null Het
Efs C T 14: 55,158,077 (GRCm39) R108Q probably damaging Het
Eif5b A G 1: 38,087,901 (GRCm39) T966A probably benign Het
Entrep2 A G 7: 64,409,153 (GRCm39) S414P probably benign Het
Flnc A C 6: 29,433,731 (GRCm39) N92H probably damaging Het
Gm13030 A T 4: 138,598,533 (GRCm39) L130H unknown Het
Gm17190 A C 13: 96,219,142 (GRCm39) R159S unknown Het
Hipk1 T C 3: 103,685,489 (GRCm39) Y42C possibly damaging Het
Ifi207 C A 1: 173,557,166 (GRCm39) C524F possibly damaging Het
Ifi207 A C 1: 173,557,504 (GRCm39) S411R probably benign Het
Ighv8-9 G T 12: 115,432,212 (GRCm39) P33H probably damaging Het
Igkv8-34 A G 6: 70,021,619 (GRCm39) V15A probably benign Het
Irx5 T A 8: 93,086,712 (GRCm39) probably null Het
Kcnh4 A G 11: 100,632,712 (GRCm39) L925P probably benign Het
Kctd9 G A 14: 67,967,141 (GRCm39) R153H possibly damaging Het
Lats1 A G 10: 7,577,880 (GRCm39) T335A probably benign Het
Med20 A G 17: 47,924,027 (GRCm39) T52A probably benign Het
Msantd4 A T 9: 4,384,095 (GRCm39) T139S possibly damaging Het
Mtif3 T C 5: 146,896,052 (GRCm39) T12A probably benign Het
N4bp2 T G 5: 65,977,655 (GRCm39) S1518A probably benign Het
Naip2 T C 13: 100,298,515 (GRCm39) N507S probably benign Het
Nasp A T 4: 116,468,112 (GRCm39) V291E probably benign Het
Ncapg2 T G 12: 116,376,036 (GRCm39) D40E probably benign Het
Nsmce1 A G 7: 125,070,319 (GRCm39) L164P probably damaging Het
Ogdhl G A 14: 32,059,763 (GRCm39) V426I probably damaging Het
Or5p66 A G 7: 107,885,904 (GRCm39) V143A probably benign Het
P3h2 T C 16: 25,811,572 (GRCm39) E217G possibly damaging Het
Pnpt1 A G 11: 29,106,875 (GRCm39) I649V probably benign Het
Prxl2c A T 13: 64,456,921 (GRCm39) Y101N Het
Pum2 G A 12: 8,771,739 (GRCm39) A361T possibly damaging Het
Rictor G A 15: 6,798,815 (GRCm39) probably null Het
Rps6ka4 G A 19: 6,814,811 (GRCm39) R264W possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,229,116 (GRCm39) probably benign Het
Sall1 T C 8: 89,755,146 (GRCm39) T1278A probably benign Het
Scg2 T A 1: 79,413,300 (GRCm39) K434N possibly damaging Het
Suclg1 T A 6: 73,237,555 (GRCm39) V100D probably damaging Het
Tarbp1 T G 8: 127,153,867 (GRCm39) E1528D possibly damaging Het
Trgc1 A G 13: 19,400,772 (GRCm39) N167S Het
Tshz2 C A 2: 169,725,575 (GRCm39) T57K probably benign Het
Ttc22 G A 4: 106,491,673 (GRCm39) R229H probably damaging Het
Vcan A G 13: 89,840,855 (GRCm39) V1563A probably benign Het
Vmn1r68 A T 7: 10,261,888 (GRCm39) M70K probably benign Het
Vmn2r105 A T 17: 20,428,904 (GRCm39) I724N probably benign Het
Vmn2r96 T C 17: 18,802,744 (GRCm39) L26P probably damaging Het
Wdr72 G A 9: 74,120,610 (GRCm39) S955N probably benign Het
Zfp518b C A 5: 38,831,838 (GRCm39) A56S probably damaging Het
Other mutations in Nipsnap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Nipsnap1 APN 11 4,839,098 (GRCm39) missense possibly damaging 0.77
IGL01552:Nipsnap1 APN 11 4,839,124 (GRCm39) missense probably damaging 1.00
IGL01744:Nipsnap1 APN 11 4,839,912 (GRCm39) missense probably damaging 1.00
IGL01938:Nipsnap1 APN 11 4,843,134 (GRCm39) missense probably benign 0.00
IGL03328:Nipsnap1 APN 11 4,834,096 (GRCm39) missense possibly damaging 0.89
R0355:Nipsnap1 UTSW 11 4,839,957 (GRCm39) missense probably damaging 1.00
R1126:Nipsnap1 UTSW 11 4,834,081 (GRCm39) missense probably benign 0.01
R1815:Nipsnap1 UTSW 11 4,839,101 (GRCm39) missense probably damaging 1.00
R2129:Nipsnap1 UTSW 11 4,838,932 (GRCm39) missense probably benign 0.04
R2205:Nipsnap1 UTSW 11 4,839,974 (GRCm39) missense possibly damaging 0.95
R4852:Nipsnap1 UTSW 11 4,841,468 (GRCm39) nonsense probably null
R5776:Nipsnap1 UTSW 11 4,838,919 (GRCm39) missense probably benign 0.00
R6073:Nipsnap1 UTSW 11 4,838,895 (GRCm39) missense possibly damaging 0.86
R7122:Nipsnap1 UTSW 11 4,833,366 (GRCm39) critical splice acceptor site probably null
R7263:Nipsnap1 UTSW 11 4,832,960 (GRCm39) unclassified probably benign
R7538:Nipsnap1 UTSW 11 4,834,089 (GRCm39) missense probably damaging 1.00
R7947:Nipsnap1 UTSW 11 4,839,145 (GRCm39) missense possibly damaging 0.64
R9164:Nipsnap1 UTSW 11 4,839,969 (GRCm39) missense probably benign 0.03
R9312:Nipsnap1 UTSW 11 4,839,902 (GRCm39) missense possibly damaging 0.55
X0011:Nipsnap1 UTSW 11 4,824,069 (GRCm39) missense probably benign
Z1177:Nipsnap1 UTSW 11 4,839,956 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGACACAGTCAAGGGATG -3'
(R):5'- GCCAACAGGTGTTTGAGTAGG -3'

Sequencing Primer
(F):5'- CAGTCAAGGGATGTAGATTCTAGATC -3'
(R):5'- TGGGGTATGAAAGAAACACACTTCC -3'
Posted On 2020-07-13