Mutagenetix > Incidental Mutations

Incidental Mutation 'R8166:Kcnh4'

633790

Institutional Source

Beutler Lab

Gene Symbol

Kcnh4

Ensembl Gene

ENSMUSG00000035355

Gene Name

potassium voltage-gated channel, subfamily H (eag-related), member 4

Synonyms

BEC2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8166 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100740376-100759942 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100741886 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 925 (L925P)

Ref Sequence

ENSEMBL: ENSMUSP00000102984 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019317] [ENSMUST00000107361] [ENSMUST00000107363] [ENSMUST00000107364] [ENSMUST00000155500]

Predicted Effect

probably benign
Transcript: ENSMUST00000019317

SMART Domains

Protein: ENSMUSP00000019317
Gene: ENSMUSG00000019173

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
RAB	22	203	6.29e-85	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107361
AA Change: L925P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102984
Gene: ENSMUSG00000035355
AA Change: L925P

Domain	Start	End	E-Value	Type
PAS	16	88	1.41e-1	SMART
PAC	94	136	4.88e-5	SMART
low complexity region	155	168	N/A	INTRINSIC
Pfam:Ion_trans	226	486	1.5e-32	PFAM
Pfam:Ion_trans_2	412	480	2.3e-12	PFAM
cNMP	556	681	1.27e-12	SMART
low complexity region	726	735	N/A	INTRINSIC
low complexity region	766	787	N/A	INTRINSIC
coiled coil region	874	911	N/A	INTRINSIC
low complexity region	981	1006	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107363
AA Change: L925P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102986
Gene: ENSMUSG00000035355
AA Change: L925P

Domain	Start	End	E-Value	Type
PAS	16	88	1.41e-1	SMART
PAC	94	136	4.88e-5	SMART
low complexity region	155	168	N/A	INTRINSIC
transmembrane domain	228	250	N/A	INTRINSIC
Pfam:Ion_trans	265	474	1.1e-17	PFAM
Pfam:Ion_trans_2	412	480	2.2e-12	PFAM
cNMP	556	681	1.27e-12	SMART
low complexity region	726	735	N/A	INTRINSIC
low complexity region	766	787	N/A	INTRINSIC
coiled coil region	874	911	N/A	INTRINSIC
low complexity region	981	1006	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107364

SMART Domains

Protein: ENSMUSP00000102987
Gene: ENSMUSG00000019173

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
RAB	22	185	3.37e-94	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155500

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. The gene is brain-specific, and located in the neocortex and the striatum. It may be involved in cellular excitability of restricted neurons in the central nervous system. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	A	T	13: 64,309,107	Y101N		Het
Acad9	T	C	3: 36,090,083	V569A	probably benign	Het
Actrt3	A	G	3: 30,598,525	F140S	probably damaging	Het
AI607873	C	A	1: 173,729,600	C524F	possibly damaging	Het
AI607873	A	C	1: 173,729,938	S411R	probably benign	Het
Alx1	T	A	10: 103,009,363	Q269L	probably damaging	Het
Amph	G	T	13: 18,948,490	A20S	possibly damaging	Het
Aqr	T	A	2: 114,113,325	M1111L	possibly damaging	Het
Atp10a	A	T	7: 58,807,522	H923L	possibly damaging	Het
Bmpr1a	A	C	14: 34,425,069	W249G	probably damaging	Het
Bmpr2	A	T	1: 59,867,581	N611I	probably damaging	Het
Cadm2	A	G	16: 66,953,309	L9S	probably benign	Het
Ccdc102a	C	A	8: 94,913,316	A117S	possibly damaging	Het
Clec4f	G	T	6: 83,652,642	S311R	possibly damaging	Het
Dchs2	T	A	3: 83,354,333	I2636N	probably benign	Het
Dync2h1	T	A	9: 7,129,089	K1809*	probably null	Het
Efs	C	T	14: 54,920,620	R108Q	probably damaging	Het
Eif5b	A	G	1: 38,048,820	T966A	probably benign	Het
Fam189a1	A	G	7: 64,759,405	S414P	probably benign	Het
Flnc	A	C	6: 29,433,732	N92H	probably damaging	Het
Gm13030	A	T	4: 138,871,222	L130H	unknown	Het
Gm17190	A	C	13: 96,082,634	R159S	unknown	Het
Hipk1	T	C	3: 103,778,173	Y42C	possibly damaging	Het
Ighv8-9	G	T	12: 115,468,592	P33H	probably damaging	Het
Igkv8-34	A	G	6: 70,044,635	V15A	probably benign	Het
Irx5	T	A	8: 92,360,084		probably null	Het
Kctd9	G	A	14: 67,729,692	R153H	possibly damaging	Het
Lats1	A	G	10: 7,702,116	T335A	probably benign	Het
Med20	A	G	17: 47,613,102	T52A	probably benign	Het
Msantd4	A	T	9: 4,384,095	T139S	possibly damaging	Het
Mtif3	T	C	5: 146,959,242	T12A	probably benign	Het
N4bp2	T	G	5: 65,820,312	S1518A	probably benign	Het
Naip2	T	C	13: 100,162,007	N507S	probably benign	Het
Nasp	A	T	4: 116,610,915	V291E	probably benign	Het
Ncapg2	T	G	12: 116,412,416	D40E	probably benign	Het
Nipsnap1	A	G	11: 4,884,057	D103G	probably benign	Het
Nsmce1	A	G	7: 125,471,147	L164P	probably damaging	Het
Ogdhl	G	A	14: 32,337,806	V426I	probably damaging	Het
Olfr490	A	G	7: 108,286,697	V143A	probably benign	Het
P3h2	T	C	16: 25,992,822	E217G	possibly damaging	Het
Pnpt1	A	G	11: 29,156,875	I649V	probably benign	Het
Pum2	G	A	12: 8,721,739	A361T	possibly damaging	Het
Rictor	G	A	15: 6,769,334		probably null	Het
Rps6ka4	G	A	19: 6,837,443	R264W	possibly damaging	Het
Rsf1	G	GACGGCGGCA	7: 97,579,909		probably benign	Het
Sall1	T	C	8: 89,028,518	T1278A	probably benign	Het
Scg2	T	A	1: 79,435,583	K434N	possibly damaging	Het
Suclg1	T	A	6: 73,260,572	V100D	probably damaging	Het
Tarbp1	T	G	8: 126,427,128	E1528D	possibly damaging	Het
Tcrg-C1	A	G	13: 19,216,602	N167S		Het
Tshz2	C	A	2: 169,883,655	T57K	probably benign	Het
Ttc22	G	A	4: 106,634,476	R229H	probably damaging	Het
Vcan	A	G	13: 89,692,736	V1563A	probably benign	Het
Vmn1r68	A	T	7: 10,527,961	M70K	probably benign	Het
Vmn2r105	A	T	17: 20,208,642	I724N	probably benign	Het
Vmn2r96	T	C	17: 18,582,482	L26P	probably damaging	Het
Wdr72	G	A	9: 74,213,328	S955N	probably benign	Het
Zfp518b	C	A	5: 38,674,495	A56S	probably damaging	Het

Other mutations in Kcnh4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Kcnh4	APN	11	100756995	splice site	probably benign
IGL00430:Kcnh4	APN	11	100757654	missense	possibly damaging	0.85
IGL02031:Kcnh4	APN	11	100745823	missense	probably damaging	1.00
IGL02346:Kcnh4	APN	11	100756942	missense	possibly damaging	0.46
IGL02674:Kcnh4	APN	11	100746894	missense	possibly damaging	0.58
IGL02903:Kcnh4	APN	11	100757654	missense	possibly damaging	0.50
IGL03152:Kcnh4	APN	11	100745772	missense	probably benign	0.00
R0032:Kcnh4	UTSW	11	100746932	missense	probably benign	0.19
R0033:Kcnh4	UTSW	11	100746932	missense	probably benign	0.19
R0066:Kcnh4	UTSW	11	100757800	missense	probably benign	0.11
R0066:Kcnh4	UTSW	11	100757800	missense	probably benign	0.11
R0242:Kcnh4	UTSW	11	100755699	missense	probably damaging	1.00
R0242:Kcnh4	UTSW	11	100755699	missense	probably damaging	1.00
R0244:Kcnh4	UTSW	11	100746932	missense	probably benign	0.19
R0310:Kcnh4	UTSW	11	100746169	missense	probably benign	0.04
R0330:Kcnh4	UTSW	11	100757743	missense	probably damaging	1.00
R0345:Kcnh4	UTSW	11	100757681	missense	probably benign	0.08
R0436:Kcnh4	UTSW	11	100746932	missense	probably benign	0.19
R0466:Kcnh4	UTSW	11	100746932	missense	probably benign	0.19
R0468:Kcnh4	UTSW	11	100746932	missense	probably benign	0.19
R0487:Kcnh4	UTSW	11	100750258	missense	probably damaging	0.99
R0562:Kcnh4	UTSW	11	100750244	missense	possibly damaging	0.80
R0613:Kcnh4	UTSW	11	100746932	missense	probably benign	0.19
R1077:Kcnh4	UTSW	11	100752338	missense	possibly damaging	0.72
R1705:Kcnh4	UTSW	11	100741772	missense	probably benign
R1840:Kcnh4	UTSW	11	100745341	missense	possibly damaging	0.46
R2114:Kcnh4	UTSW	11	100759595	missense	probably damaging	1.00
R4448:Kcnh4	UTSW	11	100755907	missense	probably benign	0.00
R4823:Kcnh4	UTSW	11	100755174	missense	probably damaging	1.00
R4865:Kcnh4	UTSW	11	100749743	missense	probably damaging	1.00
R4963:Kcnh4	UTSW	11	100752253	missense	probably damaging	1.00
R4977:Kcnh4	UTSW	11	100746833	missense	probably damaging	1.00
R5228:Kcnh4	UTSW	11	100746896	missense	probably damaging	1.00
R5385:Kcnh4	UTSW	11	100752250	missense	probably damaging	1.00
R5414:Kcnh4	UTSW	11	100746896	missense	probably damaging	1.00
R5682:Kcnh4	UTSW	11	100749802	missense	possibly damaging	0.82
R5945:Kcnh4	UTSW	11	100745322	missense	probably damaging	1.00
R6434:Kcnh4	UTSW	11	100750279	missense	probably damaging	0.97
R6505:Kcnh4	UTSW	11	100757085	missense	probably benign	0.39
R7263:Kcnh4	UTSW	11	100741817	missense	probably benign	0.06
R7270:Kcnh4	UTSW	11	100747646	missense	probably benign
R7353:Kcnh4	UTSW	11	100757199	missense	probably benign	0.18
R7355:Kcnh4	UTSW	11	100752443	missense	possibly damaging	0.92
R7544:Kcnh4	UTSW	11	100757080	missense	probably benign	0.25
R7563:Kcnh4	UTSW	11	100741854	missense	probably benign	0.00
R7664:Kcnh4	UTSW	11	100750322	missense	probably damaging	1.00
R7972:Kcnh4	UTSW	11	100752452	missense	probably damaging	0.98
R8146:Kcnh4	UTSW	11	100755279	missense	probably damaging	1.00
R8234:Kcnh4	UTSW	11	100752267	missense	possibly damaging	0.83
R8295:Kcnh4	UTSW	11	100749697	missense	probably benign	0.17
R8318:Kcnh4	UTSW	11	100752328	missense	probably damaging	1.00
R8347:Kcnh4	UTSW	11	100757749	missense	probably damaging	1.00
R8413:Kcnh4	UTSW	11	100749793	missense	possibly damaging	0.60
X0025:Kcnh4	UTSW	11	100750243	missense	possibly damaging	0.91
X0061:Kcnh4	UTSW	11	100756907	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- ATCAGGTTCCGAGGGATAGG -3'
(R):5'- GCCGACAGTGGTTGAAGAATTTTG -3'

Sequencing Primer
(F):5'- CCGAGGGATAGGGTGGTATC -3'
(R):5'- AAGAATTTTGTAAACTGTAGCGTGGG -3'

Posted On

2020-07-13