Incidental Mutation 'R8166:Amph'
ID633794
Institutional Source Beutler Lab
Gene Symbol Amph
Ensembl Gene ENSMUSG00000021314
Gene Nameamphiphysin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R8166 (G1)
Quality Score191.009
Status Validated
Chromosome13
Chromosomal Location18948205-19150921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 18948490 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 20 (A20S)
Ref Sequence ENSEMBL: ENSMUSP00000142766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]
Predicted Effect
SMART Domains Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: A20S

DomainStartEndE-ValueType
BAR 12 233 8.47e-80 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 424 445 N/A INTRINSIC
low complexity region 479 499 N/A INTRINSIC
SH3 616 686 7.82e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200466
AA Change: A20S

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: A20S

DomainStartEndE-ValueType
BAR 12 233 2.3e-82 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 428 449 N/A INTRINSIC
low complexity region 483 503 N/A INTRINSIC
SH3 620 690 4.9e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,309,107 Y101N Het
Acad9 T C 3: 36,090,083 V569A probably benign Het
Actrt3 A G 3: 30,598,525 F140S probably damaging Het
AI607873 C A 1: 173,729,600 C524F possibly damaging Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Alx1 T A 10: 103,009,363 Q269L probably damaging Het
Aqr T A 2: 114,113,325 M1111L possibly damaging Het
Atp10a A T 7: 58,807,522 H923L possibly damaging Het
Bmpr1a A C 14: 34,425,069 W249G probably damaging Het
Bmpr2 A T 1: 59,867,581 N611I probably damaging Het
Cadm2 A G 16: 66,953,309 L9S probably benign Het
Ccdc102a C A 8: 94,913,316 A117S possibly damaging Het
Clec4f G T 6: 83,652,642 S311R possibly damaging Het
Dchs2 T A 3: 83,354,333 I2636N probably benign Het
Dync2h1 T A 9: 7,129,089 K1809* probably null Het
Efs C T 14: 54,920,620 R108Q probably damaging Het
Eif5b A G 1: 38,048,820 T966A probably benign Het
Fam189a1 A G 7: 64,759,405 S414P probably benign Het
Flnc A C 6: 29,433,732 N92H probably damaging Het
Gm13030 A T 4: 138,871,222 L130H unknown Het
Gm17190 A C 13: 96,082,634 R159S unknown Het
Hipk1 T C 3: 103,778,173 Y42C possibly damaging Het
Ighv8-9 G T 12: 115,468,592 P33H probably damaging Het
Igkv8-34 A G 6: 70,044,635 V15A probably benign Het
Irx5 T A 8: 92,360,084 probably null Het
Kcnh4 A G 11: 100,741,886 L925P probably benign Het
Kctd9 G A 14: 67,729,692 R153H possibly damaging Het
Lats1 A G 10: 7,702,116 T335A probably benign Het
Med20 A G 17: 47,613,102 T52A probably benign Het
Msantd4 A T 9: 4,384,095 T139S possibly damaging Het
Mtif3 T C 5: 146,959,242 T12A probably benign Het
N4bp2 T G 5: 65,820,312 S1518A probably benign Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nasp A T 4: 116,610,915 V291E probably benign Het
Ncapg2 T G 12: 116,412,416 D40E probably benign Het
Nipsnap1 A G 11: 4,884,057 D103G probably benign Het
Nsmce1 A G 7: 125,471,147 L164P probably damaging Het
Ogdhl G A 14: 32,337,806 V426I probably damaging Het
Olfr490 A G 7: 108,286,697 V143A probably benign Het
P3h2 T C 16: 25,992,822 E217G possibly damaging Het
Pnpt1 A G 11: 29,156,875 I649V probably benign Het
Pum2 G A 12: 8,721,739 A361T possibly damaging Het
Rictor G A 15: 6,769,334 probably null Het
Rps6ka4 G A 19: 6,837,443 R264W possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall1 T C 8: 89,028,518 T1278A probably benign Het
Scg2 T A 1: 79,435,583 K434N possibly damaging Het
Suclg1 T A 6: 73,260,572 V100D probably damaging Het
Tarbp1 T G 8: 126,427,128 E1528D possibly damaging Het
Tcrg-C1 A G 13: 19,216,602 N167S Het
Tshz2 C A 2: 169,883,655 T57K probably benign Het
Ttc22 G A 4: 106,634,476 R229H probably damaging Het
Vcan A G 13: 89,692,736 V1563A probably benign Het
Vmn1r68 A T 7: 10,527,961 M70K probably benign Het
Vmn2r105 A T 17: 20,208,642 I724N probably benign Het
Vmn2r96 T C 17: 18,582,482 L26P probably damaging Het
Wdr72 G A 9: 74,213,328 S955N probably benign Het
Zfp518b C A 5: 38,674,495 A56S probably damaging Het
Other mutations in Amph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Amph APN 13 19120606 missense probably damaging 1.00
IGL01866:Amph APN 13 19142002 missense probably damaging 1.00
IGL02157:Amph APN 13 19104231 missense possibly damaging 0.60
IGL02300:Amph APN 13 19086604 missense probably damaging 1.00
IGL02435:Amph APN 13 19139163 splice site probably benign
IGL03060:Amph APN 13 19094814 missense probably damaging 0.99
IGL03122:Amph APN 13 19102943 missense probably damaging 0.98
R0037:Amph UTSW 13 19100653 missense possibly damaging 0.90
R0646:Amph UTSW 13 19113116 missense possibly damaging 0.95
R0652:Amph UTSW 13 19086621 splice site probably null
R1005:Amph UTSW 13 19142028 missense probably damaging 0.97
R1006:Amph UTSW 13 19142028 missense probably damaging 0.97
R1199:Amph UTSW 13 19142028 missense probably damaging 0.97
R1200:Amph UTSW 13 19142028 missense probably damaging 0.97
R1201:Amph UTSW 13 19142028 missense probably damaging 0.97
R1333:Amph UTSW 13 19142028 missense probably damaging 0.97
R1334:Amph UTSW 13 19142028 missense probably damaging 0.97
R1335:Amph UTSW 13 19142028 missense probably damaging 0.97
R1337:Amph UTSW 13 19142028 missense probably damaging 0.97
R1338:Amph UTSW 13 19142028 missense probably damaging 0.97
R1384:Amph UTSW 13 19142028 missense probably damaging 0.97
R1397:Amph UTSW 13 19142028 missense probably damaging 0.97
R1501:Amph UTSW 13 19104291 nonsense probably null
R1528:Amph UTSW 13 19142028 missense probably damaging 0.97
R1822:Amph UTSW 13 18948455 missense probably damaging 0.98
R2004:Amph UTSW 13 19142028 missense probably damaging 0.97
R2006:Amph UTSW 13 19142028 missense probably damaging 0.97
R2061:Amph UTSW 13 19125035 nonsense probably null
R2111:Amph UTSW 13 19116266 splice site probably benign
R2329:Amph UTSW 13 19139350 missense probably benign
R2878:Amph UTSW 13 19104267 missense possibly damaging 0.95
R3121:Amph UTSW 13 19113146 nonsense probably null
R3548:Amph UTSW 13 19102959 missense probably damaging 1.00
R4059:Amph UTSW 13 19141998 missense probably damaging 1.00
R4369:Amph UTSW 13 19137700 missense probably benign 0.20
R4492:Amph UTSW 13 19149758 missense possibly damaging 0.76
R4855:Amph UTSW 13 19084208 missense probably damaging 1.00
R4937:Amph UTSW 13 19104345 missense probably damaging 1.00
R4965:Amph UTSW 13 19137699 missense probably benign 0.12
R5777:Amph UTSW 13 19046016 missense probably damaging 1.00
R5787:Amph UTSW 13 18948454 missense possibly damaging 0.75
R6091:Amph UTSW 13 19125123 missense probably benign 0.01
R7100:Amph UTSW 13 19149841 makesense probably null
R7103:Amph UTSW 13 19149738 missense probably benign 0.00
R7451:Amph UTSW 13 19077368 missense probably damaging 1.00
R7522:Amph UTSW 13 19086545 missense probably damaging 0.96
R8165:Amph UTSW 13 19094837 missense probably benign 0.05
R8214:Amph UTSW 13 19104298 missense possibly damaging 0.81
V1662:Amph UTSW 13 19139370 missense probably benign 0.36
Z1177:Amph UTSW 13 19139334 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTTAAACCGGTCCTGTCGC -3'
(R):5'- CTGCAATCGTTGAGAGCAGAG -3'

Sequencing Primer
(F):5'- CCTCTGCTCCTCACGCTTCAG -3'
(R):5'- AGAGACAGGGGAGTCCTCC -3'
Posted On2020-07-13