Incidental Mutation 'R8166:Kctd9'
ID633803
Institutional Source Beutler Lab
Gene Symbol Kctd9
Ensembl Gene ENSMUSG00000034327
Gene Namepotassium channel tetramerisation domain containing 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8166 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location67715937-67742310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67729692 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 153 (R153H)
Ref Sequence ENSEMBL: ENSMUSP00000077200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078053] [ENSMUST00000125212] [ENSMUST00000145542] [ENSMUST00000150768] [ENSMUST00000152243] [ENSMUST00000156700]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078053
AA Change: R153H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077200
Gene: ENSMUSG00000034327
AA Change: R153H

DomainStartEndE-ValueType
Pfam:DUF3354 1 65 3.5e-22 PFAM
BTB 89 192 1.76e-16 SMART
Pfam:Pentapeptide 253 292 1e-14 PFAM
Pfam:Pentapeptide_4 258 334 2.7e-15 PFAM
Pfam:Pentapeptide 288 327 6.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125212
Predicted Effect possibly damaging
Transcript: ENSMUST00000145542
AA Change: R39H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000150768
AA Change: R153H

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114489
Gene: ENSMUSG00000034327
AA Change: R153H

DomainStartEndE-ValueType
Pfam:KHA 2 64 1.4e-21 PFAM
BTB 89 192 1.76e-16 SMART
Pfam:Pentapeptide 219 255 9.3e-8 PFAM
Pfam:Pentapeptide 248 280 9.3e-11 PFAM
Pfam:Pentapeptide 258 297 3e-10 PFAM
Pfam:Pentapeptide 303 342 3.2e-13 PFAM
Pfam:Pentapeptide_4 308 384 3.3e-13 PFAM
Pfam:Pentapeptide 338 377 2.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152243
AA Change: R39H

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000120440
Gene: ENSMUSG00000034327
AA Change: R39H

DomainStartEndE-ValueType
Pfam:BTB_2 1 70 1.3e-13 PFAM
Pfam:BTB 1 78 6.2e-7 PFAM
Pfam:Pentapeptide 105 137 4.3e-8 PFAM
Pfam:Pentapeptide 134 166 5.5e-11 PFAM
Pfam:Pentapeptide 144 183 1.5e-10 PFAM
Pfam:Pentapeptide_4 165 239 5.3e-9 PFAM
Pfam:Pentapeptide 189 228 1.7e-13 PFAM
Pfam:Pentapeptide 209 237 9.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156700
SMART Domains Protein: ENSMUSP00000115002
Gene: ENSMUSG00000034327

DomainStartEndE-ValueType
Pfam:DUF3354 1 65 2.5e-23 PFAM
SCOP:d3kvt__ 89 107 9e-4 SMART
Meta Mutation Damage Score 0.7015 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,309,107 Y101N Het
Acad9 T C 3: 36,090,083 V569A probably benign Het
Actrt3 A G 3: 30,598,525 F140S probably damaging Het
AI607873 C A 1: 173,729,600 C524F possibly damaging Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Alx1 T A 10: 103,009,363 Q269L probably damaging Het
Amph G T 13: 18,948,490 A20S possibly damaging Het
Aqr T A 2: 114,113,325 M1111L possibly damaging Het
Atp10a A T 7: 58,807,522 H923L possibly damaging Het
Bmpr1a A C 14: 34,425,069 W249G probably damaging Het
Bmpr2 A T 1: 59,867,581 N611I probably damaging Het
Cadm2 A G 16: 66,953,309 L9S probably benign Het
Ccdc102a C A 8: 94,913,316 A117S possibly damaging Het
Clec4f G T 6: 83,652,642 S311R possibly damaging Het
Dchs2 T A 3: 83,354,333 I2636N probably benign Het
Dync2h1 T A 9: 7,129,089 K1809* probably null Het
Efs C T 14: 54,920,620 R108Q probably damaging Het
Eif5b A G 1: 38,048,820 T966A probably benign Het
Fam189a1 A G 7: 64,759,405 S414P probably benign Het
Flnc A C 6: 29,433,732 N92H probably damaging Het
Gm13030 A T 4: 138,871,222 L130H unknown Het
Gm17190 A C 13: 96,082,634 R159S unknown Het
Hipk1 T C 3: 103,778,173 Y42C possibly damaging Het
Ighv8-9 G T 12: 115,468,592 P33H probably damaging Het
Igkv8-34 A G 6: 70,044,635 V15A probably benign Het
Irx5 T A 8: 92,360,084 probably null Het
Kcnh4 A G 11: 100,741,886 L925P probably benign Het
Lats1 A G 10: 7,702,116 T335A probably benign Het
Med20 A G 17: 47,613,102 T52A probably benign Het
Msantd4 A T 9: 4,384,095 T139S possibly damaging Het
Mtif3 T C 5: 146,959,242 T12A probably benign Het
N4bp2 T G 5: 65,820,312 S1518A probably benign Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nasp A T 4: 116,610,915 V291E probably benign Het
Ncapg2 T G 12: 116,412,416 D40E probably benign Het
Nipsnap1 A G 11: 4,884,057 D103G probably benign Het
Nsmce1 A G 7: 125,471,147 L164P probably damaging Het
Ogdhl G A 14: 32,337,806 V426I probably damaging Het
Olfr490 A G 7: 108,286,697 V143A probably benign Het
P3h2 T C 16: 25,992,822 E217G possibly damaging Het
Pnpt1 A G 11: 29,156,875 I649V probably benign Het
Pum2 G A 12: 8,721,739 A361T possibly damaging Het
Rictor G A 15: 6,769,334 probably null Het
Rps6ka4 G A 19: 6,837,443 R264W possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall1 T C 8: 89,028,518 T1278A probably benign Het
Scg2 T A 1: 79,435,583 K434N possibly damaging Het
Suclg1 T A 6: 73,260,572 V100D probably damaging Het
Tarbp1 T G 8: 126,427,128 E1528D possibly damaging Het
Tcrg-C1 A G 13: 19,216,602 N167S Het
Tshz2 C A 2: 169,883,655 T57K probably benign Het
Ttc22 G A 4: 106,634,476 R229H probably damaging Het
Vcan A G 13: 89,692,736 V1563A probably benign Het
Vmn1r68 A T 7: 10,527,961 M70K probably benign Het
Vmn2r105 A T 17: 20,208,642 I724N probably benign Het
Vmn2r96 T C 17: 18,582,482 L26P probably damaging Het
Wdr72 G A 9: 74,213,328 S955N probably benign Het
Zfp518b C A 5: 38,674,495 A56S probably damaging Het
Other mutations in Kctd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02706:Kctd9 APN 14 67724681 critical splice donor site probably null
IGL03034:Kctd9 APN 14 67734279 missense probably benign 0.36
domain UTSW 14 67724673 nonsense probably null
model UTSW 14 67729692 missense possibly damaging 0.95
motif UTSW 14 67729356 missense probably damaging 1.00
Prototype UTSW 14 67740387 missense probably damaging 1.00
R0686:Kctd9 UTSW 14 67728736 missense probably damaging 1.00
R1069:Kctd9 UTSW 14 67729420 splice site probably benign
R3737:Kctd9 UTSW 14 67734288 missense possibly damaging 0.92
R3738:Kctd9 UTSW 14 67734288 missense possibly damaging 0.92
R4785:Kctd9 UTSW 14 67734164 missense probably damaging 1.00
R4939:Kctd9 UTSW 14 67729686 missense probably damaging 1.00
R4989:Kctd9 UTSW 14 67729356 missense probably damaging 1.00
R5133:Kctd9 UTSW 14 67729356 missense probably damaging 1.00
R5138:Kctd9 UTSW 14 67728748 critical splice donor site probably null
R5232:Kctd9 UTSW 14 67724661 missense probably damaging 1.00
R5454:Kctd9 UTSW 14 67740387 missense probably damaging 1.00
R6642:Kctd9 UTSW 14 67724673 nonsense probably null
R7128:Kctd9 UTSW 14 67738523 missense probably benign 0.02
R7863:Kctd9 UTSW 14 67729717 missense possibly damaging 0.84
R8068:Kctd9 UTSW 14 67724662 missense unknown
Predicted Primers PCR Primer
(F):5'- AACTGGCGTGGGATCAAATC -3'
(R):5'- GTCCCCTGTGATAGAACTTAAATCTAC -3'

Sequencing Primer
(F):5'- GGGATCAAATCGTTTTTATGGCAG -3'
(R):5'- CCATCCTGATACCTACACTG -3'
Posted On2020-07-13