Incidental Mutation 'R8166:Med20'
ID633809
Institutional Source Beutler Lab
Gene Symbol Med20
Ensembl Gene ENSMUSG00000092558
Gene Namemediator complex subunit 20
SynonymsTrfp, 1110011O05Rik, 2410115I17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8166 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location47611582-47624418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47613102 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 52 (T52A)
Ref Sequence ENSEMBL: ENSMUSP00000024778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024778] [ENSMUST00000024783] [ENSMUST00000132397]
Predicted Effect probably benign
Transcript: ENSMUST00000024778
AA Change: T52A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024778
Gene: ENSMUSG00000092558
AA Change: T52A

DomainStartEndE-ValueType
Pfam:Med20 1 198 6.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024783
SMART Domains Protein: ENSMUSP00000024783
Gene: ENSMUSG00000023988

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
low complexity region 52 69 N/A INTRINSIC
Pfam:Bystin 140 430 1.1e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132397
AA Change: T52A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117658
Gene: ENSMUSG00000023984
AA Change: T52A

DomainStartEndE-ValueType
Pfam:Med20 1 149 1.6e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. A mutation in this gene has been associated with a novel infantile-onset neurodegenerative movement disorder. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,309,107 Y101N Het
Acad9 T C 3: 36,090,083 V569A probably benign Het
Actrt3 A G 3: 30,598,525 F140S probably damaging Het
AI607873 C A 1: 173,729,600 C524F possibly damaging Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Alx1 T A 10: 103,009,363 Q269L probably damaging Het
Amph G T 13: 18,948,490 A20S possibly damaging Het
Aqr T A 2: 114,113,325 M1111L possibly damaging Het
Atp10a A T 7: 58,807,522 H923L possibly damaging Het
Bmpr1a A C 14: 34,425,069 W249G probably damaging Het
Bmpr2 A T 1: 59,867,581 N611I probably damaging Het
Cadm2 A G 16: 66,953,309 L9S probably benign Het
Ccdc102a C A 8: 94,913,316 A117S possibly damaging Het
Clec4f G T 6: 83,652,642 S311R possibly damaging Het
Dchs2 T A 3: 83,354,333 I2636N probably benign Het
Dync2h1 T A 9: 7,129,089 K1809* probably null Het
Efs C T 14: 54,920,620 R108Q probably damaging Het
Eif5b A G 1: 38,048,820 T966A probably benign Het
Fam189a1 A G 7: 64,759,405 S414P probably benign Het
Flnc A C 6: 29,433,732 N92H probably damaging Het
Gm13030 A T 4: 138,871,222 L130H unknown Het
Gm17190 A C 13: 96,082,634 R159S unknown Het
Hipk1 T C 3: 103,778,173 Y42C possibly damaging Het
Ighv8-9 G T 12: 115,468,592 P33H probably damaging Het
Igkv8-34 A G 6: 70,044,635 V15A probably benign Het
Irx5 T A 8: 92,360,084 probably null Het
Kcnh4 A G 11: 100,741,886 L925P probably benign Het
Kctd9 G A 14: 67,729,692 R153H possibly damaging Het
Lats1 A G 10: 7,702,116 T335A probably benign Het
Msantd4 A T 9: 4,384,095 T139S possibly damaging Het
Mtif3 T C 5: 146,959,242 T12A probably benign Het
N4bp2 T G 5: 65,820,312 S1518A probably benign Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nasp A T 4: 116,610,915 V291E probably benign Het
Ncapg2 T G 12: 116,412,416 D40E probably benign Het
Nipsnap1 A G 11: 4,884,057 D103G probably benign Het
Nsmce1 A G 7: 125,471,147 L164P probably damaging Het
Ogdhl G A 14: 32,337,806 V426I probably damaging Het
Olfr490 A G 7: 108,286,697 V143A probably benign Het
P3h2 T C 16: 25,992,822 E217G possibly damaging Het
Pnpt1 A G 11: 29,156,875 I649V probably benign Het
Pum2 G A 12: 8,721,739 A361T possibly damaging Het
Rictor G A 15: 6,769,334 probably null Het
Rps6ka4 G A 19: 6,837,443 R264W possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall1 T C 8: 89,028,518 T1278A probably benign Het
Scg2 T A 1: 79,435,583 K434N possibly damaging Het
Suclg1 T A 6: 73,260,572 V100D probably damaging Het
Tarbp1 T G 8: 126,427,128 E1528D possibly damaging Het
Tcrg-C1 A G 13: 19,216,602 N167S Het
Tshz2 C A 2: 169,883,655 T57K probably benign Het
Ttc22 G A 4: 106,634,476 R229H probably damaging Het
Vcan A G 13: 89,692,736 V1563A probably benign Het
Vmn1r68 A T 7: 10,527,961 M70K probably benign Het
Vmn2r105 A T 17: 20,208,642 I724N probably benign Het
Vmn2r96 T C 17: 18,582,482 L26P probably damaging Het
Wdr72 G A 9: 74,213,328 S955N probably benign Het
Zfp518b C A 5: 38,674,495 A56S probably damaging Het
Other mutations in Med20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Med20 APN 17 47623000 missense possibly damaging 0.92
R0847:Med20 UTSW 17 47611693 critical splice donor site probably null
R0881:Med20 UTSW 17 47611680 start codon destroyed probably null 1.00
R4460:Med20 UTSW 17 47618917 missense probably benign 0.39
R4461:Med20 UTSW 17 47618917 missense probably benign 0.39
R5212:Med20 UTSW 17 47618850 missense probably benign 0.02
R5605:Med20 UTSW 17 47623144 intron probably benign
V7580:Med20 UTSW 17 47618832 missense probably damaging 1.00
V7582:Med20 UTSW 17 47618832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCCTAGCCCTGCTGATC -3'
(R):5'- TGACCACCATAATATAAGATGGACC -3'

Sequencing Primer
(F):5'- CAGAAGCTCTGTGTCTCTGGAC -3'
(R):5'- CCATAATATAAGATGGACCAAGAACG -3'
Posted On2020-07-13