Incidental Mutation 'R8166:Rps6ka4'
ID633810
Institutional Source Beutler Lab
Gene Symbol Rps6ka4
Ensembl Gene ENSMUSG00000024952
Gene Nameribosomal protein S6 kinase, polypeptide 4
Synonyms1110069D02Rik, MSK2, 90kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R8166 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6829085-6840601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6837443 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 264 (R264W)
Ref Sequence ENSEMBL: ENSMUSP00000025903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025903] [ENSMUST00000170516]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025903
AA Change: R264W

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025903
Gene: ENSMUSG00000024952
AA Change: R264W

DomainStartEndE-ValueType
S_TKc 33 301 1.93e-98 SMART
S_TK_X 302 363 5.72e-14 SMART
low complexity region 381 395 N/A INTRINSIC
S_TKc 411 674 1.15e-87 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170516
AA Change: R264W

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131581
Gene: ENSMUSG00000024952
AA Change: R264W

DomainStartEndE-ValueType
S_TKc 33 301 1.93e-98 SMART
S_TK_X 302 363 5.72e-14 SMART
low complexity region 381 395 N/A INTRINSIC
S_TKc 411 674 1.15e-87 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains 2 non-identical kinase catalytic domains and phosphorylates various substrates, including CREB1 and ATF1. The encoded protein can also phosphorylate histone H3 to regulate certain inflammatory genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: No phenotypic information associated with mutations in this gene have been reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,309,107 Y101N Het
Acad9 T C 3: 36,090,083 V569A probably benign Het
Actrt3 A G 3: 30,598,525 F140S probably damaging Het
AI607873 C A 1: 173,729,600 C524F possibly damaging Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Alx1 T A 10: 103,009,363 Q269L probably damaging Het
Amph G T 13: 18,948,490 A20S possibly damaging Het
Aqr T A 2: 114,113,325 M1111L possibly damaging Het
Atp10a A T 7: 58,807,522 H923L possibly damaging Het
Bmpr1a A C 14: 34,425,069 W249G probably damaging Het
Bmpr2 A T 1: 59,867,581 N611I probably damaging Het
Cadm2 A G 16: 66,953,309 L9S probably benign Het
Ccdc102a C A 8: 94,913,316 A117S possibly damaging Het
Clec4f G T 6: 83,652,642 S311R possibly damaging Het
Dchs2 T A 3: 83,354,333 I2636N probably benign Het
Dync2h1 T A 9: 7,129,089 K1809* probably null Het
Efs C T 14: 54,920,620 R108Q probably damaging Het
Eif5b A G 1: 38,048,820 T966A probably benign Het
Fam189a1 A G 7: 64,759,405 S414P probably benign Het
Flnc A C 6: 29,433,732 N92H probably damaging Het
Gm13030 A T 4: 138,871,222 L130H unknown Het
Gm17190 A C 13: 96,082,634 R159S unknown Het
Hipk1 T C 3: 103,778,173 Y42C possibly damaging Het
Ighv8-9 G T 12: 115,468,592 P33H probably damaging Het
Igkv8-34 A G 6: 70,044,635 V15A probably benign Het
Irx5 T A 8: 92,360,084 probably null Het
Kcnh4 A G 11: 100,741,886 L925P probably benign Het
Kctd9 G A 14: 67,729,692 R153H possibly damaging Het
Lats1 A G 10: 7,702,116 T335A probably benign Het
Med20 A G 17: 47,613,102 T52A probably benign Het
Msantd4 A T 9: 4,384,095 T139S possibly damaging Het
Mtif3 T C 5: 146,959,242 T12A probably benign Het
N4bp2 T G 5: 65,820,312 S1518A probably benign Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nasp A T 4: 116,610,915 V291E probably benign Het
Ncapg2 T G 12: 116,412,416 D40E probably benign Het
Nipsnap1 A G 11: 4,884,057 D103G probably benign Het
Nsmce1 A G 7: 125,471,147 L164P probably damaging Het
Ogdhl G A 14: 32,337,806 V426I probably damaging Het
Olfr490 A G 7: 108,286,697 V143A probably benign Het
P3h2 T C 16: 25,992,822 E217G possibly damaging Het
Pnpt1 A G 11: 29,156,875 I649V probably benign Het
Pum2 G A 12: 8,721,739 A361T possibly damaging Het
Rictor G A 15: 6,769,334 probably null Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall1 T C 8: 89,028,518 T1278A probably benign Het
Scg2 T A 1: 79,435,583 K434N possibly damaging Het
Suclg1 T A 6: 73,260,572 V100D probably damaging Het
Tarbp1 T G 8: 126,427,128 E1528D possibly damaging Het
Tcrg-C1 A G 13: 19,216,602 N167S Het
Tshz2 C A 2: 169,883,655 T57K probably benign Het
Ttc22 G A 4: 106,634,476 R229H probably damaging Het
Vcan A G 13: 89,692,736 V1563A probably benign Het
Vmn1r68 A T 7: 10,527,961 M70K probably benign Het
Vmn2r105 A T 17: 20,208,642 I724N probably benign Het
Vmn2r96 T C 17: 18,582,482 L26P probably damaging Het
Wdr72 G A 9: 74,213,328 S955N probably benign Het
Zfp518b C A 5: 38,674,495 A56S probably damaging Het
Other mutations in Rps6ka4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Rps6ka4 APN 19 6831128 missense probably damaging 1.00
IGL01548:Rps6ka4 APN 19 6832323 missense probably benign 0.02
IGL02536:Rps6ka4 APN 19 6832071 missense probably damaging 1.00
IGL02902:Rps6ka4 APN 19 6832255 critical splice donor site probably null
IGL03299:Rps6ka4 APN 19 6832247 splice site probably benign
R0510:Rps6ka4 UTSW 19 6840498 missense probably benign 0.13
R1104:Rps6ka4 UTSW 19 6830996 missense probably damaging 1.00
R1620:Rps6ka4 UTSW 19 6838149 missense probably damaging 1.00
R1647:Rps6ka4 UTSW 19 6839362 missense probably benign 0.15
R1648:Rps6ka4 UTSW 19 6839362 missense probably benign 0.15
R1939:Rps6ka4 UTSW 19 6839466 missense probably damaging 1.00
R2370:Rps6ka4 UTSW 19 6830100 missense possibly damaging 0.93
R2412:Rps6ka4 UTSW 19 6829941 makesense probably null
R2571:Rps6ka4 UTSW 19 6838103 missense probably damaging 1.00
R2698:Rps6ka4 UTSW 19 6837352 missense probably benign 0.08
R3427:Rps6ka4 UTSW 19 6837755 critical splice donor site probably null
R3721:Rps6ka4 UTSW 19 6839277 missense possibly damaging 0.73
R3844:Rps6ka4 UTSW 19 6837803 nonsense probably null
R4092:Rps6ka4 UTSW 19 6832255 critical splice donor site probably null
R4169:Rps6ka4 UTSW 19 6831820 missense possibly damaging 0.92
R4677:Rps6ka4 UTSW 19 6839486 missense probably damaging 1.00
R4897:Rps6ka4 UTSW 19 6838099 missense probably benign 0.02
R4975:Rps6ka4 UTSW 19 6840310 splice site probably null
R5631:Rps6ka4 UTSW 19 6830977 splice site probably benign
R6462:Rps6ka4 UTSW 19 6837589 missense possibly damaging 0.90
R6643:Rps6ka4 UTSW 19 6832363 missense probably damaging 1.00
R6939:Rps6ka4 UTSW 19 6838069 missense probably damaging 1.00
R7030:Rps6ka4 UTSW 19 6839624 missense probably damaging 1.00
R7902:Rps6ka4 UTSW 19 6831311 missense possibly damaging 0.81
R8021:Rps6ka4 UTSW 19 6830409 missense probably benign 0.01
U24488:Rps6ka4 UTSW 19 6832356 missense probably damaging 1.00
X0019:Rps6ka4 UTSW 19 6838140 missense probably damaging 0.97
X0027:Rps6ka4 UTSW 19 6837772 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGATGGAATACATTTGTGCTCCC -3'
(R):5'- TGGGTATCCTGCTCTTCGAG -3'

Sequencing Primer
(F):5'- GGAATACATTTGTGCTCCCCATGC -3'
(R):5'- TCTTCGAGCTGCTGACAGG -3'
Posted On2020-07-13