Incidental Mutation 'R8167:Raph1'
ID 633812
Institutional Source Beutler Lab
Gene Symbol Raph1
Ensembl Gene ENSMUSG00000026014
Gene Name Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R8167 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 60482292-60567104 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 60490111 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 664 (M664L)
Ref Sequence ENSEMBL: ENSMUSP00000121023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]
AlphaFold F2Z3U3
Predicted Effect probably benign
Transcript: ENSMUST00000027168
SMART Domains Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090293
SMART Domains Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140485
AA Change: M664L
SMART Domains Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: M664L

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
RA 270 356 1.63e-13 SMART
PH 398 508 3.38e-11 SMART
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182085
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik A G 15: 98,588,667 H106R probably benign Het
4931406B18Rik T A 7: 43,497,864 I315F possibly damaging Het
A430078G23Rik A T 8: 3,353,636 probably benign Het
Acin1 G A 14: 54,664,880 T485I probably benign Het
Adamts2 A T 11: 50,779,714 I552F probably damaging Het
Anapc11 T A 11: 120,599,286 N9K probably benign Het
Atp9b T C 18: 80,847,183 T314A Het
Birc6 T A 17: 74,643,394 I3214N probably damaging Het
Catsperb A G 12: 101,591,455 I762V probably benign Het
Cblb T A 16: 52,166,002 M536K probably benign Het
Ccdc85c C A 12: 108,274,500 A212S unknown Het
Cdh23 T A 10: 60,314,383 D2561V probably benign Het
Cdh23 T A 10: 60,337,693 Y1672F probably damaging Het
Cep83 T C 10: 94,728,717 S173P possibly damaging Het
Ctc1 C T 11: 69,027,758 P530S probably damaging Het
D630045J12Rik A G 6: 38,190,549 probably null Het
Dnah7b A T 1: 46,253,511 I3019F possibly damaging Het
Dsc1 T C 18: 20,097,201 D349G probably damaging Het
Ehd2 C G 7: 15,963,992 G107R probably damaging Het
Epha3 A T 16: 63,568,441 W816R probably damaging Het
Fam135b T A 15: 71,532,991 S69C probably null Het
Fbxo43 A G 15: 36,151,771 F600S probably damaging Het
Flnc A T 6: 29,455,922 D2117V probably damaging Het
Gas2l3 T A 10: 89,426,480 T127S probably damaging Het
Gli3 T G 13: 15,725,643 L1205R probably benign Het
Gm17093 A T 14: 44,520,682 I107F Het
Gm7298 T A 6: 121,784,455 C1323* probably null Het
Gm8298 T A 3: 59,877,211 D368E probably benign Het
H2-D1 A G 17: 35,266,765 T89A Het
Hira T G 16: 18,896,509 D52E probably benign Het
Ighv6-6 G C 12: 114,434,905 Y80* probably null Het
Kat6b C T 14: 21,669,885 T1435I probably damaging Het
Kcna1 C A 6: 126,643,480 probably benign Het
Kif24 C A 4: 41,392,957 R1284L possibly damaging Het
Kremen2 A C 17: 23,743,340 C173G probably damaging Het
Krtap24-1 G C 16: 88,611,819 Q140E probably benign Het
Lrrc66 C A 5: 73,629,609 G133* probably null Het
Mast1 C A 8: 84,921,358 R498L probably damaging Het
Myom3 T C 4: 135,807,193 I1231T possibly damaging Het
Nid2 G A 14: 19,810,063 V1350I possibly damaging Het
Olfr1062 A G 2: 86,423,140 C179R probably damaging Het
Olfr1312 A T 2: 112,042,444 V196D possibly damaging Het
Olfr823 T C 10: 130,112,481 Q103R probably damaging Het
Pde4a A G 9: 21,206,173 D577G possibly damaging Het
Pde4d T A 13: 109,442,321 N36K probably benign Het
Plekhg1 A T 10: 3,957,452 S845C Het
Plekhg1 G A 10: 3,957,453 S845N Het
Plod1 C T 4: 147,920,201 D481N probably damaging Het
Plxna4 T A 6: 32,517,046 M212L probably damaging Het
Ppip5k1 C A 2: 121,342,801 E464* probably null Het
Rbm11 A C 16: 75,598,785 M115L probably benign Het
Rerg T C 6: 137,057,871 H45R possibly damaging Het
Rnf43 A G 11: 87,727,406 E47G probably benign Het
Rsph1 A G 17: 31,277,286 probably benign Het
Safb A G 17: 56,585,286 E42G unknown Het
Scn1a A T 2: 66,324,838 D592E probably damaging Het
Sdf4 T G 4: 156,008,922 V237G possibly damaging Het
Slc44a2 C A 9: 21,346,772 H439Q possibly damaging Het
Smg7 A T 1: 152,844,372 N761K possibly damaging Het
Snrpb2 A G 2: 143,068,364 E114G probably benign Het
Ssh1 T C 5: 113,951,990 D346G possibly damaging Het
Svopl T A 6: 38,017,044 I351F probably damaging Het
Tgfb2 A G 1: 186,690,745 S136P possibly damaging Het
Thsd7a A T 6: 12,317,401 L1636* probably null Het
Tmc2 A G 2: 130,241,568 T482A probably benign Het
Tnk2 C A 16: 32,680,262 P798T probably damaging Het
Trim5 T C 7: 104,278,423 Y170C probably damaging Het
Ttll10 T C 4: 156,044,756 M310V probably null Het
Unc13c T A 9: 73,736,703 T1160S probably damaging Het
Usp25 A T 16: 77,107,931 D795V probably damaging Het
Usp28 T A 9: 49,037,848 V914E probably damaging Het
Utrn A T 10: 12,671,814 C1627* probably null Het
Vmn1r28 C A 6: 58,266,067 F298L noncoding transcript Het
Vps29 T C 5: 122,362,814 S69P possibly damaging Het
Zfp703 T A 8: 26,979,754 L482H probably damaging Het
Other mutations in Raph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02300:Raph1 APN 1 60525947 missense possibly damaging 0.76
IGL02900:Raph1 APN 1 60502863 missense probably damaging 1.00
FR4976:Raph1 UTSW 1 60489267 intron probably benign
R0048:Raph1 UTSW 1 60500605 missense probably benign 0.03
R0048:Raph1 UTSW 1 60500605 missense probably benign 0.03
R0049:Raph1 UTSW 1 60525899 missense probably benign 0.03
R0049:Raph1 UTSW 1 60525899 missense probably benign 0.03
R0227:Raph1 UTSW 1 60525977 missense probably benign 0.00
R0387:Raph1 UTSW 1 60510496 intron probably benign
R0607:Raph1 UTSW 1 60525869 missense probably damaging 1.00
R1740:Raph1 UTSW 1 60519024 nonsense probably null
R2274:Raph1 UTSW 1 60498500 missense probably damaging 1.00
R3108:Raph1 UTSW 1 60493386 missense probably benign 0.01
R3977:Raph1 UTSW 1 60498523 missense probably benign 0.39
R4260:Raph1 UTSW 1 60502965 missense possibly damaging 0.94
R4487:Raph1 UTSW 1 60502869 missense possibly damaging 0.68
R4721:Raph1 UTSW 1 60503001 unclassified probably benign
R4782:Raph1 UTSW 1 60489114 missense probably damaging 1.00
R5027:Raph1 UTSW 1 60496277 missense probably damaging 1.00
R5037:Raph1 UTSW 1 60496222 splice site probably null
R5106:Raph1 UTSW 1 60533300 missense probably damaging 1.00
R5506:Raph1 UTSW 1 60493498 intron probably benign
R5510:Raph1 UTSW 1 60522946 unclassified probably benign
R5587:Raph1 UTSW 1 60498473 missense probably damaging 1.00
R5591:Raph1 UTSW 1 60501746 unclassified probably benign
R5619:Raph1 UTSW 1 60490255 intron probably benign
R5776:Raph1 UTSW 1 60490156 intron probably benign
R5802:Raph1 UTSW 1 60488673 missense possibly damaging 0.81
R6742:Raph1 UTSW 1 60525720 missense probably damaging 0.97
R7122:Raph1 UTSW 1 60525977 missense probably benign 0.10
R7219:Raph1 UTSW 1 60502873 missense unknown
R7251:Raph1 UTSW 1 60489868 missense unknown
R7254:Raph1 UTSW 1 60499608 missense unknown
R7732:Raph1 UTSW 1 60533288 missense possibly damaging 0.82
R7979:Raph1 UTSW 1 60525989 missense probably benign 0.00
R7986:Raph1 UTSW 1 60496286 missense
R8168:Raph1 UTSW 1 60499620 missense unknown
R8399:Raph1 UTSW 1 60489318 missense unknown
R9036:Raph1 UTSW 1 60502965 missense unknown
R9146:Raph1 UTSW 1 60518978 critical splice donor site probably null
R9338:Raph1 UTSW 1 60490141 missense unknown
R9381:Raph1 UTSW 1 60501800 missense unknown
R9383:Raph1 UTSW 1 60525670 missense unknown
R9399:Raph1 UTSW 1 60525995 missense probably benign
R9454:Raph1 UTSW 1 60489594 missense unknown
R9561:Raph1 UTSW 1 60525728 missense possibly damaging 0.49
RF018:Raph1 UTSW 1 60489267 intron probably benign
RF022:Raph1 UTSW 1 60489267 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTAACTGGGCCATGGCTGAG -3'
(R):5'- TATGAATCGGTCCTACACTTCAC -3'

Sequencing Primer
(F):5'- CCAGGGGTTGGGGGTGG -3'
(R):5'- GAATCGGTCCTACACTTCACTTATG -3'
Posted On 2020-07-13