Incidental Mutation 'R8167:Raph1'
ID 633812
Institutional Source Beutler Lab
Gene Symbol Raph1
Ensembl Gene ENSMUSG00000026014
Gene Name Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms C730009O10Rik, lamellipodin, 9430025M21Rik, Lpd
MMRRC Submission 067593-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R8167 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 60521451-60606263 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 60529270 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 664 (M664L)
Ref Sequence ENSEMBL: ENSMUSP00000121023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]
AlphaFold F2Z3U3
Predicted Effect probably benign
Transcript: ENSMUST00000027168
SMART Domains Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090293
SMART Domains Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140485
AA Change: M664L
SMART Domains Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: M664L

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
RA 270 356 1.63e-13 SMART
PH 398 508 3.38e-11 SMART
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182085
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T A 7: 43,147,288 (GRCm39) I315F possibly damaging Het
Aadacl2fm3 T A 3: 59,784,632 (GRCm39) D368E probably benign Het
Acin1 G A 14: 54,902,337 (GRCm39) T485I probably benign Het
Adamts2 A T 11: 50,670,541 (GRCm39) I552F probably damaging Het
Anapc11 T A 11: 120,490,112 (GRCm39) N9K probably benign Het
Arhgef18 A T 8: 3,403,636 (GRCm39) probably benign Het
Atp9b T C 18: 80,890,398 (GRCm39) T314A Het
Birc6 T A 17: 74,950,389 (GRCm39) I3214N probably damaging Het
Catsperb A G 12: 101,557,714 (GRCm39) I762V probably benign Het
Cblb T A 16: 51,986,365 (GRCm39) M536K probably benign Het
Ccdc85c C A 12: 108,240,759 (GRCm39) A212S unknown Het
Cdh23 T A 10: 60,150,162 (GRCm39) D2561V probably benign Het
Cdh23 T A 10: 60,173,472 (GRCm39) Y1672F probably damaging Het
Cep83 T C 10: 94,564,579 (GRCm39) S173P possibly damaging Het
Ctc1 C T 11: 68,918,584 (GRCm39) P530S probably damaging Het
D630045J12Rik A G 6: 38,167,484 (GRCm39) probably null Het
Dnah7b A T 1: 46,292,671 (GRCm39) I3019F possibly damaging Het
Dsc1 T C 18: 20,230,258 (GRCm39) D349G probably damaging Het
Ehd2 C G 7: 15,697,917 (GRCm39) G107R probably damaging Het
Epha3 A T 16: 63,388,804 (GRCm39) W816R probably damaging Het
Fam135b T A 15: 71,404,840 (GRCm39) S69C probably null Het
Fbxo43 A G 15: 36,151,917 (GRCm39) F600S probably damaging Het
Flnc A T 6: 29,455,921 (GRCm39) D2117V probably damaging Het
Gas2l3 T A 10: 89,262,342 (GRCm39) T127S probably damaging Het
Gli3 T G 13: 15,900,228 (GRCm39) L1205R probably benign Het
Gm17093 A T 14: 44,758,139 (GRCm39) I107F Het
Gm7298 T A 6: 121,761,414 (GRCm39) C1323* probably null Het
H2-D1 A G 17: 35,485,741 (GRCm39) T89A Het
Hira T G 16: 18,715,259 (GRCm39) D52E probably benign Het
Ighv6-6 G C 12: 114,398,525 (GRCm39) Y80* probably null Het
Kat6b C T 14: 21,719,953 (GRCm39) T1435I probably damaging Het
Kcna1 C A 6: 126,620,443 (GRCm39) probably benign Het
Kif24 C A 4: 41,392,957 (GRCm39) R1284L possibly damaging Het
Kremen2 A C 17: 23,962,314 (GRCm39) C173G probably damaging Het
Krtap24-1 G C 16: 88,408,707 (GRCm39) Q140E probably benign Het
Lrrc66 C A 5: 73,786,952 (GRCm39) G133* probably null Het
Mast1 C A 8: 85,647,987 (GRCm39) R498L probably damaging Het
Myom3 T C 4: 135,534,504 (GRCm39) I1231T possibly damaging Het
Nid2 G A 14: 19,860,131 (GRCm39) V1350I possibly damaging Het
Or4f59 A T 2: 111,872,789 (GRCm39) V196D possibly damaging Het
Or8j3c A G 2: 86,253,484 (GRCm39) C179R probably damaging Het
Or9r3 T C 10: 129,948,350 (GRCm39) Q103R probably damaging Het
Pde4a A G 9: 21,117,469 (GRCm39) D577G possibly damaging Het
Pde4d T A 13: 109,578,855 (GRCm39) N36K probably benign Het
Plekhg1 A T 10: 3,907,452 (GRCm39) S845C Het
Plekhg1 G A 10: 3,907,453 (GRCm39) S845N Het
Plod1 C T 4: 148,004,658 (GRCm39) D481N probably damaging Het
Plxna4 T A 6: 32,493,981 (GRCm39) M212L probably damaging Het
Ppip5k1 C A 2: 121,173,282 (GRCm39) E464* probably null Het
Rbm11 A C 16: 75,395,673 (GRCm39) M115L probably benign Het
Rerg T C 6: 137,034,869 (GRCm39) H45R possibly damaging Het
Rnf43 A G 11: 87,618,232 (GRCm39) E47G probably benign Het
Rsph1 A G 17: 31,496,260 (GRCm39) probably benign Het
Safb A G 17: 56,892,286 (GRCm39) E42G unknown Het
Scn1a A T 2: 66,155,182 (GRCm39) D592E probably damaging Het
Sdf4 T G 4: 156,093,379 (GRCm39) V237G possibly damaging Het
Slc44a2 C A 9: 21,258,068 (GRCm39) H439Q possibly damaging Het
Smg7 A T 1: 152,720,123 (GRCm39) N761K possibly damaging Het
Snrpb2 A G 2: 142,910,284 (GRCm39) E114G probably benign Het
Spmip11 A G 15: 98,486,548 (GRCm39) H106R probably benign Het
Ssh1 T C 5: 114,090,051 (GRCm39) D346G possibly damaging Het
Svopl T A 6: 37,993,979 (GRCm39) I351F probably damaging Het
Tgfb2 A G 1: 186,422,942 (GRCm39) S136P possibly damaging Het
Thsd7a A T 6: 12,317,400 (GRCm39) L1636* probably null Het
Tmc2 A G 2: 130,083,488 (GRCm39) T482A probably benign Het
Tnk2 C A 16: 32,499,080 (GRCm39) P798T probably damaging Het
Trim5 T C 7: 103,927,630 (GRCm39) Y170C probably damaging Het
Ttll10 T C 4: 156,129,213 (GRCm39) M310V probably null Het
Unc13c T A 9: 73,643,985 (GRCm39) T1160S probably damaging Het
Usp25 A T 16: 76,904,819 (GRCm39) D795V probably damaging Het
Usp28 T A 9: 48,949,148 (GRCm39) V914E probably damaging Het
Utrn A T 10: 12,547,558 (GRCm39) C1627* probably null Het
Vmn1r28 C A 6: 58,243,052 (GRCm39) F298L noncoding transcript Het
Vps29 T C 5: 122,500,877 (GRCm39) S69P possibly damaging Het
Zfp703 T A 8: 27,469,782 (GRCm39) L482H probably damaging Het
Other mutations in Raph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02300:Raph1 APN 1 60,565,106 (GRCm39) missense possibly damaging 0.76
IGL02900:Raph1 APN 1 60,542,022 (GRCm39) missense probably damaging 1.00
FR4976:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
R0048:Raph1 UTSW 1 60,539,764 (GRCm39) missense probably benign 0.03
R0048:Raph1 UTSW 1 60,539,764 (GRCm39) missense probably benign 0.03
R0049:Raph1 UTSW 1 60,565,058 (GRCm39) missense probably benign 0.03
R0049:Raph1 UTSW 1 60,565,058 (GRCm39) missense probably benign 0.03
R0227:Raph1 UTSW 1 60,565,136 (GRCm39) missense probably benign 0.00
R0387:Raph1 UTSW 1 60,549,655 (GRCm39) intron probably benign
R0607:Raph1 UTSW 1 60,565,028 (GRCm39) missense probably damaging 1.00
R1740:Raph1 UTSW 1 60,558,183 (GRCm39) nonsense probably null
R2274:Raph1 UTSW 1 60,537,659 (GRCm39) missense probably damaging 1.00
R3108:Raph1 UTSW 1 60,532,545 (GRCm39) missense probably benign 0.01
R3977:Raph1 UTSW 1 60,537,682 (GRCm39) missense probably benign 0.39
R4260:Raph1 UTSW 1 60,542,124 (GRCm39) missense possibly damaging 0.94
R4487:Raph1 UTSW 1 60,542,028 (GRCm39) missense possibly damaging 0.68
R4721:Raph1 UTSW 1 60,542,160 (GRCm39) unclassified probably benign
R4782:Raph1 UTSW 1 60,528,273 (GRCm39) missense probably damaging 1.00
R5027:Raph1 UTSW 1 60,535,436 (GRCm39) missense probably damaging 1.00
R5037:Raph1 UTSW 1 60,535,381 (GRCm39) splice site probably null
R5106:Raph1 UTSW 1 60,572,459 (GRCm39) missense probably damaging 1.00
R5506:Raph1 UTSW 1 60,532,657 (GRCm39) intron probably benign
R5510:Raph1 UTSW 1 60,562,105 (GRCm39) unclassified probably benign
R5587:Raph1 UTSW 1 60,537,632 (GRCm39) missense probably damaging 1.00
R5591:Raph1 UTSW 1 60,540,905 (GRCm39) unclassified probably benign
R5619:Raph1 UTSW 1 60,529,414 (GRCm39) intron probably benign
R5776:Raph1 UTSW 1 60,529,315 (GRCm39) intron probably benign
R5802:Raph1 UTSW 1 60,527,832 (GRCm39) missense possibly damaging 0.81
R6742:Raph1 UTSW 1 60,564,879 (GRCm39) missense probably damaging 0.97
R7122:Raph1 UTSW 1 60,565,136 (GRCm39) missense probably benign 0.10
R7219:Raph1 UTSW 1 60,542,032 (GRCm39) missense unknown
R7251:Raph1 UTSW 1 60,529,027 (GRCm39) missense unknown
R7254:Raph1 UTSW 1 60,538,767 (GRCm39) missense unknown
R7732:Raph1 UTSW 1 60,572,447 (GRCm39) missense possibly damaging 0.82
R7979:Raph1 UTSW 1 60,565,148 (GRCm39) missense probably benign 0.00
R7986:Raph1 UTSW 1 60,535,445 (GRCm39) missense
R8168:Raph1 UTSW 1 60,538,779 (GRCm39) missense unknown
R8399:Raph1 UTSW 1 60,528,477 (GRCm39) missense unknown
R9036:Raph1 UTSW 1 60,542,124 (GRCm39) missense unknown
R9146:Raph1 UTSW 1 60,558,137 (GRCm39) critical splice donor site probably null
R9338:Raph1 UTSW 1 60,529,300 (GRCm39) missense unknown
R9381:Raph1 UTSW 1 60,540,959 (GRCm39) missense unknown
R9383:Raph1 UTSW 1 60,564,829 (GRCm39) missense unknown
R9399:Raph1 UTSW 1 60,565,154 (GRCm39) missense probably benign
R9454:Raph1 UTSW 1 60,528,753 (GRCm39) missense unknown
R9561:Raph1 UTSW 1 60,564,887 (GRCm39) missense possibly damaging 0.49
RF018:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
RF022:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- TTAACTGGGCCATGGCTGAG -3'
(R):5'- TATGAATCGGTCCTACACTTCAC -3'

Sequencing Primer
(F):5'- CCAGGGGTTGGGGGTGG -3'
(R):5'- GAATCGGTCCTACACTTCACTTATG -3'
Posted On 2020-07-13