Incidental Mutation 'R8167:Tmc2'
ID633819
Institutional Source Beutler Lab
Gene Symbol Tmc2
Ensembl Gene ENSMUSG00000060332
Gene Nametransmembrane channel-like gene family 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R8167 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130195194-130264445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130241568 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 482 (T482A)
Ref Sequence ENSEMBL: ENSMUSP00000077139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077988] [ENSMUST00000166774]
Predicted Effect probably benign
Transcript: ENSMUST00000077988
AA Change: T482A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077139
Gene: ENSMUSG00000060332
AA Change: T482A

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 8.6e-41 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166774
AA Change: T482A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125843
Gene: ENSMUSG00000060332
AA Change: T482A

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 1.2e-36 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is necesssary for mechanotransduction in cochlear hair cells of the inner ear. Mutations in this gene may underlie hereditary disorders of balance and hearing. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele display normal hearing and motor behavior. Cochlear hair cells show partial resistance to gentamicin induced toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik A G 15: 98,588,667 H106R probably benign Het
4931406B18Rik T A 7: 43,497,864 I315F possibly damaging Het
A430078G23Rik A T 8: 3,353,636 probably benign Het
Acin1 G A 14: 54,664,880 T485I probably benign Het
Adamts2 A T 11: 50,779,714 I552F probably damaging Het
Anapc11 T A 11: 120,599,286 N9K probably benign Het
Atp9b T C 18: 80,847,183 T314A Het
Birc6 T A 17: 74,643,394 I3214N probably damaging Het
Catsperb A G 12: 101,591,455 I762V probably benign Het
Cblb T A 16: 52,166,002 M536K probably benign Het
Ccdc85c C A 12: 108,274,500 A212S unknown Het
Cdh23 T A 10: 60,314,383 D2561V probably benign Het
Cdh23 T A 10: 60,337,693 Y1672F probably damaging Het
Cep83 T C 10: 94,728,717 S173P possibly damaging Het
Ctc1 C T 11: 69,027,758 P530S probably damaging Het
D630045J12Rik A G 6: 38,190,549 probably null Het
Dnah7b A T 1: 46,253,511 I3019F possibly damaging Het
Dsc1 T C 18: 20,097,201 D349G probably damaging Het
Ehd2 C G 7: 15,963,992 G107R probably damaging Het
Epha3 A T 16: 63,568,441 W816R probably damaging Het
Fam135b T A 15: 71,532,991 S69C probably null Het
Fbxo43 A G 15: 36,151,771 F600S probably damaging Het
Flnc A T 6: 29,455,922 D2117V probably damaging Het
Gas2l3 T A 10: 89,426,480 T127S probably damaging Het
Gli3 T G 13: 15,725,643 L1205R probably benign Het
Gm17093 A T 14: 44,520,682 I107F Het
Gm7298 T A 6: 121,784,455 C1323* probably null Het
Gm8298 T A 3: 59,877,211 D368E probably benign Het
H2-D1 A G 17: 35,266,765 T89A Het
Hira T G 16: 18,896,509 D52E probably benign Het
Ighv6-6 G C 12: 114,434,905 Y80* probably null Het
Kat6b C T 14: 21,669,885 T1435I probably damaging Het
Kcna1 C A 6: 126,643,480 probably benign Het
Kif24 C A 4: 41,392,957 R1284L possibly damaging Het
Kremen2 A C 17: 23,743,340 C173G probably damaging Het
Krtap24-1 G C 16: 88,611,819 Q140E probably benign Het
Lrrc66 C A 5: 73,629,609 G133* probably null Het
Mast1 C A 8: 84,921,358 R498L probably damaging Het
Myom3 T C 4: 135,807,193 I1231T possibly damaging Het
Nid2 G A 14: 19,810,063 V1350I possibly damaging Het
Olfr1062 A G 2: 86,423,140 C179R probably damaging Het
Olfr1312 A T 2: 112,042,444 V196D possibly damaging Het
Olfr823 T C 10: 130,112,481 Q103R probably damaging Het
Pde4a A G 9: 21,206,173 D577G possibly damaging Het
Pde4d T A 13: 109,442,321 N36K probably benign Het
Plekhg1 A T 10: 3,957,452 S845C Het
Plekhg1 G A 10: 3,957,453 S845N Het
Plod1 C T 4: 147,920,201 D481N probably damaging Het
Plxna4 T A 6: 32,517,046 M212L probably damaging Het
Ppip5k1 C A 2: 121,342,801 E464* probably null Het
Raph1 T A 1: 60,490,111 M664L unknown Het
Rbm11 A C 16: 75,598,785 M115L probably benign Het
Rerg T C 6: 137,057,871 H45R possibly damaging Het
Rnf43 A G 11: 87,727,406 E47G probably benign Het
Rsph1 A G 17: 31,277,286 probably benign Het
Safb A G 17: 56,585,286 E42G unknown Het
Scn1a A T 2: 66,324,838 D592E probably damaging Het
Sdf4 T G 4: 156,008,922 V237G possibly damaging Het
Slc44a2 C A 9: 21,346,772 H439Q possibly damaging Het
Smg7 A T 1: 152,844,372 N761K possibly damaging Het
Snrpb2 A G 2: 143,068,364 E114G probably benign Het
Ssh1 T C 5: 113,951,990 D346G possibly damaging Het
Svopl T A 6: 38,017,044 I351F probably damaging Het
Tgfb2 A G 1: 186,690,745 S136P possibly damaging Het
Thsd7a A T 6: 12,317,401 L1636* probably null Het
Tnk2 C A 16: 32,680,262 P798T probably damaging Het
Trim5 T C 7: 104,278,423 Y170C probably damaging Het
Ttll10 T C 4: 156,044,756 M310V probably null Het
Unc13c T A 9: 73,736,703 T1160S probably damaging Het
Usp25 A T 16: 77,107,931 D795V probably damaging Het
Usp28 T A 9: 49,037,848 V914E probably damaging Het
Utrn A T 10: 12,671,814 C1627* probably null Het
Vmn1r28 C A 6: 58,266,067 F298L noncoding transcript Het
Vps29 T C 5: 122,362,814 S69P possibly damaging Het
Zfp703 T A 8: 26,979,754 L482H probably damaging Het
Other mutations in Tmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tmc2 APN 2 130261304 missense possibly damaging 0.94
IGL00966:Tmc2 APN 2 130264012 missense probably benign 0.02
IGL01094:Tmc2 APN 2 130260166 splice site probably benign
IGL01331:Tmc2 APN 2 130232356 missense probably damaging 1.00
IGL01660:Tmc2 APN 2 130260224 nonsense probably null
IGL01926:Tmc2 APN 2 130260240 missense possibly damaging 0.68
IGL02150:Tmc2 APN 2 130240153 missense probably damaging 0.98
IGL02273:Tmc2 APN 2 130229206 missense probably damaging 0.99
IGL03137:Tmc2 APN 2 130240130 missense probably damaging 1.00
IGL03179:Tmc2 APN 2 130229187 missense probably damaging 1.00
FR4449:Tmc2 UTSW 2 130240196 missense probably damaging 1.00
H8786:Tmc2 UTSW 2 130226262 missense probably damaging 1.00
PIT4418001:Tmc2 UTSW 2 130248651 missense probably damaging 0.96
R0364:Tmc2 UTSW 2 130202103 missense probably benign 0.00
R1183:Tmc2 UTSW 2 130247976 missense probably damaging 1.00
R1446:Tmc2 UTSW 2 130248730 missense probably damaging 0.97
R1458:Tmc2 UTSW 2 130248762 missense probably damaging 1.00
R1589:Tmc2 UTSW 2 130247960 missense probably damaging 0.99
R1656:Tmc2 UTSW 2 130247934 missense possibly damaging 0.93
R1686:Tmc2 UTSW 2 130256116 missense possibly damaging 0.71
R1765:Tmc2 UTSW 2 130260225 missense probably benign 0.34
R1776:Tmc2 UTSW 2 130234869 missense probably damaging 1.00
R1873:Tmc2 UTSW 2 130248756 missense possibly damaging 0.68
R1972:Tmc2 UTSW 2 130214664 splice site probably benign
R2020:Tmc2 UTSW 2 130232385 missense probably damaging 1.00
R2208:Tmc2 UTSW 2 130214563 splice site probably null
R3968:Tmc2 UTSW 2 130202071 missense probably benign 0.02
R4732:Tmc2 UTSW 2 130261397 splice site probably null
R4733:Tmc2 UTSW 2 130261397 splice site probably null
R4989:Tmc2 UTSW 2 130202041 missense possibly damaging 0.88
R5143:Tmc2 UTSW 2 130234818 missense probably damaging 0.98
R5411:Tmc2 UTSW 2 130240115 missense probably damaging 1.00
R5514:Tmc2 UTSW 2 130241644 missense possibly damaging 0.94
R5690:Tmc2 UTSW 2 130232386 missense probably damaging 1.00
R5983:Tmc2 UTSW 2 130247976 missense probably damaging 1.00
R6451:Tmc2 UTSW 2 130264203 missense probably damaging 0.99
R6927:Tmc2 UTSW 2 130261380 missense probably benign
R7132:Tmc2 UTSW 2 130232409 missense possibly damaging 0.82
R7240:Tmc2 UTSW 2 130234804 missense possibly damaging 0.80
R7353:Tmc2 UTSW 2 130196577 critical splice donor site probably null
R8554:Tmc2 UTSW 2 130264164 missense probably benign 0.00
X0019:Tmc2 UTSW 2 130208285 missense possibly damaging 0.59
X0052:Tmc2 UTSW 2 130201972 missense probably benign 0.00
Z1177:Tmc2 UTSW 2 130208296 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GTGTTCTTATACACTGAGCCATCTCAC -3'
(R):5'- CTATGACAGCTGTGAAGCAAC -3'

Sequencing Primer
(F):5'- TATACACTGAGCCATCTCACCATCTC -3'
(R):5'- TGTGAAGCAACATAGAAAAACCTGC -3'
Posted On2020-07-13