Incidental Mutation 'R8167:Pde4a'
ID633845
Institutional Source Beutler Lab
Gene Symbol Pde4a
Ensembl Gene ENSMUSG00000032177
Gene Namephosphodiesterase 4A, cAMP specific
SynonymsDpde2, dunce, D9Ertd60e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R8167 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location21165714-21213248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21206173 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 577 (D577G)
Ref Sequence ENSEMBL: ENSMUSP00000037025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003395] [ENSMUST00000039413] [ENSMUST00000115458]
Predicted Effect probably damaging
Transcript: ENSMUST00000003395
AA Change: D343G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003395
Gene: ENSMUSG00000032177
AA Change: D343G

DomainStartEndE-ValueType
low complexity region 62 87 N/A INTRINSIC
HDc 182 357 7.12e-5 SMART
low complexity region 462 475 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000039413
AA Change: D577G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037025
Gene: ENSMUSG00000032177
AA Change: D577G

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 92 102 N/A INTRINSIC
low complexity region 296 321 N/A INTRINSIC
HDc 416 591 7.12e-5 SMART
low complexity region 696 709 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115458
AA Change: D520G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111118
Gene: ENSMUSG00000032177
AA Change: D520G

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
HDc 359 534 7.12e-5 SMART
low complexity region 639 652 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik A G 15: 98,588,667 H106R probably benign Het
4931406B18Rik T A 7: 43,497,864 I315F possibly damaging Het
A430078G23Rik A T 8: 3,353,636 probably benign Het
Acin1 G A 14: 54,664,880 T485I probably benign Het
Adamts2 A T 11: 50,779,714 I552F probably damaging Het
Anapc11 T A 11: 120,599,286 N9K probably benign Het
Atp9b T C 18: 80,847,183 T314A Het
Birc6 T A 17: 74,643,394 I3214N probably damaging Het
Catsperb A G 12: 101,591,455 I762V probably benign Het
Cblb T A 16: 52,166,002 M536K probably benign Het
Ccdc85c C A 12: 108,274,500 A212S unknown Het
Cdh23 T A 10: 60,314,383 D2561V probably benign Het
Cdh23 T A 10: 60,337,693 Y1672F probably damaging Het
Cep83 T C 10: 94,728,717 S173P possibly damaging Het
Ctc1 C T 11: 69,027,758 P530S probably damaging Het
D630045J12Rik A G 6: 38,190,549 probably null Het
Dnah7b A T 1: 46,253,511 I3019F possibly damaging Het
Dsc1 T C 18: 20,097,201 D349G probably damaging Het
Ehd2 C G 7: 15,963,992 G107R probably damaging Het
Epha3 A T 16: 63,568,441 W816R probably damaging Het
Fam135b T A 15: 71,532,991 S69C probably null Het
Fbxo43 A G 15: 36,151,771 F600S probably damaging Het
Flnc A T 6: 29,455,922 D2117V probably damaging Het
Gas2l3 T A 10: 89,426,480 T127S probably damaging Het
Gli3 T G 13: 15,725,643 L1205R probably benign Het
Gm17093 A T 14: 44,520,682 I107F Het
Gm7298 T A 6: 121,784,455 C1323* probably null Het
Gm8298 T A 3: 59,877,211 D368E probably benign Het
H2-D1 A G 17: 35,266,765 T89A Het
Hira T G 16: 18,896,509 D52E probably benign Het
Ighv6-6 G C 12: 114,434,905 Y80* probably null Het
Kat6b C T 14: 21,669,885 T1435I probably damaging Het
Kcna1 C A 6: 126,643,480 probably benign Het
Kif24 C A 4: 41,392,957 R1284L possibly damaging Het
Kremen2 A C 17: 23,743,340 C173G probably damaging Het
Krtap24-1 G C 16: 88,611,819 Q140E probably benign Het
Lrrc66 C A 5: 73,629,609 G133* probably null Het
Mast1 C A 8: 84,921,358 R498L probably damaging Het
Myom3 T C 4: 135,807,193 I1231T possibly damaging Het
Nid2 G A 14: 19,810,063 V1350I possibly damaging Het
Olfr1062 A G 2: 86,423,140 C179R probably damaging Het
Olfr1312 A T 2: 112,042,444 V196D possibly damaging Het
Olfr823 T C 10: 130,112,481 Q103R probably damaging Het
Pde4d T A 13: 109,442,321 N36K probably benign Het
Plekhg1 A T 10: 3,957,452 S845C Het
Plekhg1 G A 10: 3,957,453 S845N Het
Plod1 C T 4: 147,920,201 D481N probably damaging Het
Plxna4 T A 6: 32,517,046 M212L probably damaging Het
Ppip5k1 C A 2: 121,342,801 E464* probably null Het
Raph1 T A 1: 60,490,111 M664L unknown Het
Rbm11 A C 16: 75,598,785 M115L probably benign Het
Rerg T C 6: 137,057,871 H45R possibly damaging Het
Rnf43 A G 11: 87,727,406 E47G probably benign Het
Rsph1 A G 17: 31,277,286 probably benign Het
Safb A G 17: 56,585,286 E42G unknown Het
Scn1a A T 2: 66,324,838 D592E probably damaging Het
Sdf4 T G 4: 156,008,922 V237G possibly damaging Het
Slc44a2 C A 9: 21,346,772 H439Q possibly damaging Het
Smg7 A T 1: 152,844,372 N761K possibly damaging Het
Snrpb2 A G 2: 143,068,364 E114G probably benign Het
Ssh1 T C 5: 113,951,990 D346G possibly damaging Het
Svopl T A 6: 38,017,044 I351F probably damaging Het
Tgfb2 A G 1: 186,690,745 S136P possibly damaging Het
Thsd7a A T 6: 12,317,401 L1636* probably null Het
Tmc2 A G 2: 130,241,568 T482A probably benign Het
Tnk2 C A 16: 32,680,262 P798T probably damaging Het
Trim5 T C 7: 104,278,423 Y170C probably damaging Het
Ttll10 T C 4: 156,044,756 M310V probably null Het
Unc13c T A 9: 73,736,703 T1160S probably damaging Het
Usp25 A T 16: 77,107,931 D795V probably damaging Het
Usp28 T A 9: 49,037,848 V914E probably damaging Het
Utrn A T 10: 12,671,814 C1627* probably null Het
Vmn1r28 C A 6: 58,266,067 F298L noncoding transcript Het
Vps29 T C 5: 122,362,814 S69P possibly damaging Het
Zfp703 T A 8: 26,979,754 L482H probably damaging Het
Other mutations in Pde4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pde4a APN 9 21211061 missense probably benign 0.01
IGL01330:Pde4a APN 9 21192438 splice site probably benign
IGL01403:Pde4a APN 9 21205116 missense probably damaging 1.00
IGL01610:Pde4a APN 9 21211350 utr 3 prime probably benign
IGL02010:Pde4a APN 9 21203554 critical splice donor site probably null
IGL02296:Pde4a APN 9 21192569 missense possibly damaging 0.94
IGL02637:Pde4a APN 9 21201332 missense probably damaging 0.97
PIT4696001:Pde4a UTSW 9 21211001 missense probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0257:Pde4a UTSW 9 21192421 missense probably damaging 1.00
R0504:Pde4a UTSW 9 21204403 missense probably damaging 1.00
R1437:Pde4a UTSW 9 21192592 critical splice donor site probably null
R1524:Pde4a UTSW 9 21201247 missense probably damaging 0.98
R1750:Pde4a UTSW 9 21203232 missense probably damaging 1.00
R2239:Pde4a UTSW 9 21211268 missense probably damaging 1.00
R2905:Pde4a UTSW 9 21201349 missense probably benign 0.01
R2991:Pde4a UTSW 9 21203243 missense probably damaging 0.96
R3972:Pde4a UTSW 9 21206217 missense probably damaging 1.00
R4826:Pde4a UTSW 9 21192380 splice site probably null
R4922:Pde4a UTSW 9 21210713 missense probably damaging 1.00
R5195:Pde4a UTSW 9 21204333 missense possibly damaging 0.70
R5208:Pde4a UTSW 9 21203558 splice site probably null
R5552:Pde4a UTSW 9 21201386 missense probably damaging 1.00
R5713:Pde4a UTSW 9 21203517 missense probably damaging 1.00
R6722:Pde4a UTSW 9 21211225 missense probably damaging 1.00
R6792:Pde4a UTSW 9 21192590 missense probably benign 0.03
R6861:Pde4a UTSW 9 21205301 missense probably damaging 1.00
R6901:Pde4a UTSW 9 21204970 missense probably benign 0.37
R7300:Pde4a UTSW 9 21206322 missense probably damaging 1.00
R7690:Pde4a UTSW 9 21166004 missense probably damaging 1.00
R7798:Pde4a UTSW 9 21198663 missense possibly damaging 0.63
R8073:Pde4a UTSW 9 21210769 missense probably damaging 1.00
R8133:Pde4a UTSW 9 21191377 missense possibly damaging 0.87
R8297:Pde4a UTSW 9 21166108 missense possibly damaging 0.94
R8348:Pde4a UTSW 9 21206238 missense probably benign 0.35
R8448:Pde4a UTSW 9 21206238 missense probably benign 0.35
X0027:Pde4a UTSW 9 21198654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGTACCCCACTCAGCTTC -3'
(R):5'- TGTACCCGCCGTACCTGAG -3'

Sequencing Primer
(F):5'- CAGCTGGGACTCTATTTGGAAACC -3'
(R):5'- GTACCTGAGACTTCTCCACAGAGG -3'
Posted On2020-07-13