Mutagenetix > Incidental Mutation

Incidental Mutation 'R0692:Srbd1'

63386

Institutional Source

Beutler Lab

Gene Symbol

Srbd1

Ensembl Gene

ENSMUSG00000024135

Gene Name

S1 RNA binding domain 1

Synonyms

MMRRC Submission

038877-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R0692 (G1)

Quality Score

131

Status

Not validated

Chromosome

Chromosomal Location

85984665-86145175 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86136460 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 113 (T113A)

Ref Sequence

ENSEMBL: ENSMUSP00000092810 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095187]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000095187
AA Change: T113A

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000092810
Gene: ENSMUSG00000024135
AA Change: T113A

Domain	Start	End	E-Value	Type
low complexity region	20	33	N/A	INTRINSIC
low complexity region	104	128	N/A	INTRINSIC
Pfam:Tex_N	213	403	2.8e-43	PFAM
YqgFc	532	631	4.1e-32	SMART
Pfam:HHH_7	668	764	1.6e-6	PFAM
Pfam:HHH_3	698	762	4.2e-25	PFAM
S1	903	978	7e-15	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Add3	T	A	19: 53,216,952	D44E	probably damaging	Het
Bpifb5	T	C	2: 154,234,696	V421A	probably benign	Het
Clk4	C	T	11: 51,281,328	R273*	probably null	Het
Cmya5	A	T	13: 93,093,849	L1577*	probably null	Het
Col14a1	G	C	15: 55,341,738	G88A	unknown	Het
Helz2	A	G	2: 181,240,881	C40R	probably benign	Het
Kcng1	T	A	2: 168,262,763	I388F	probably damaging	Het
Krt35	T	C	11: 100,093,070	E368G	possibly damaging	Het
Krt81	T	C	15: 101,460,172	D400G	possibly damaging	Het
Mcm3ap	T	C	10: 76,483,169	C744R	probably damaging	Het
Olfr1033	A	G	2: 86,042,172	M286V	probably benign	Het
Pde6c	A	T	19: 38,180,250	Y788F	probably damaging	Het
Plxnc1	A	G	10: 94,837,500		probably null	Het
Rflnb	T	C	11: 76,027,453	D62G	probably benign	Het
Sema4f	CCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGC	6: 82,939,530		probably benign	Het
Slc12a1	T	A	2: 125,194,162	Y651*	probably null	Het
Svopl	A	T	6: 38,017,196	L300Q	probably damaging	Het
Trim41	C	T	11: 48,808,250		probably null	Het
Vmn1r23	C	A	6: 57,926,125	E223*	probably null	Het

Other mutations in Srbd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Srbd1	APN	17	86115209	missense	probably damaging	1.00
IGL00988:Srbd1	APN	17	86130270	missense	probably damaging	0.96
IGL01111:Srbd1	APN	17	86098533	missense	probably benign	0.15
IGL02186:Srbd1	APN	17	86109231	missense	probably benign
IGL02233:Srbd1	APN	17	86098622	splice site	probably null
IGL02307:Srbd1	APN	17	86126188	missense	probably damaging	1.00
IGL02392:Srbd1	APN	17	85988373	missense	probably benign	0.34
IGL02831:Srbd1	APN	17	86003871	missense	probably damaging	1.00
IGL03299:Srbd1	APN	17	86120659	missense	possibly damaging	0.95
PIT4494001:Srbd1	UTSW	17	86142359	critical splice donor site	probably null
PIT4677001:Srbd1	UTSW	17	86115212	nonsense	probably null
R0233:Srbd1	UTSW	17	86057745	missense	probably damaging	1.00
R0233:Srbd1	UTSW	17	86057745	missense	probably damaging	1.00
R0464:Srbd1	UTSW	17	86120002	missense	probably damaging	1.00
R0771:Srbd1	UTSW	17	86130254	missense	probably benign	0.09
R1074:Srbd1	UTSW	17	86003952	missense	probably damaging	1.00
R1173:Srbd1	UTSW	17	86098512	missense	probably null	1.00
R1446:Srbd1	UTSW	17	86139152	missense	probably benign	0.44
R1587:Srbd1	UTSW	17	85985437	missense	probably damaging	1.00
R1780:Srbd1	UTSW	17	86057685	missense	probably damaging	1.00
R1865:Srbd1	UTSW	17	86115304	splice site	probably benign
R1933:Srbd1	UTSW	17	86102893	missense	probably damaging	1.00
R1934:Srbd1	UTSW	17	86102893	missense	probably damaging	1.00
R2002:Srbd1	UTSW	17	86142400	missense	probably benign
R2228:Srbd1	UTSW	17	85985223	missense	probably damaging	1.00
R3160:Srbd1	UTSW	17	86130215	missense	probably benign	0.03
R3162:Srbd1	UTSW	17	86130215	missense	probably benign	0.03
R3162:Srbd1	UTSW	17	86130215	missense	probably benign	0.03
R3439:Srbd1	UTSW	17	86057759	missense	probably benign	0.01
R3611:Srbd1	UTSW	17	86102927	missense	probably benign	0.03
R4255:Srbd1	UTSW	17	86102922	missense	possibly damaging	0.80
R4300:Srbd1	UTSW	17	85985204	missense	probably damaging	0.98
R4319:Srbd1	UTSW	17	86051150	missense	probably damaging	1.00
R4619:Srbd1	UTSW	17	86109265	missense	probably benign	0.30
R4620:Srbd1	UTSW	17	86109265	missense	probably benign	0.30
R4629:Srbd1	UTSW	17	86120672	missense	probably damaging	0.99
R5379:Srbd1	UTSW	17	86001536	missense	possibly damaging	0.88
R5469:Srbd1	UTSW	17	86119942	missense	possibly damaging	0.77
R5587:Srbd1	UTSW	17	86127801	missense	probably damaging	0.99
R5726:Srbd1	UTSW	17	86120729	missense	possibly damaging	0.89
R6166:Srbd1	UTSW	17	86099268	missense	probably damaging	1.00
R6237:Srbd1	UTSW	17	85985295	missense	probably damaging	0.99
R6696:Srbd1	UTSW	17	86139191	missense	possibly damaging	0.46
R6971:Srbd1	UTSW	17	86099290	missense	possibly damaging	0.79
R6986:Srbd1	UTSW	17	85985222	missense	probably damaging	1.00
R7018:Srbd1	UTSW	17	86136415	missense	possibly damaging	0.93
R7082:Srbd1	UTSW	17	86057732	missense	probably damaging	1.00
R7209:Srbd1	UTSW	17	86001520	missense	probably damaging	1.00
R7340:Srbd1	UTSW	17	86136354	missense	probably benign	0.02
R7417:Srbd1	UTSW	17	86136321	missense	probably benign
R7467:Srbd1	UTSW	17	86099274	missense	probably damaging	0.96
R7833:Srbd1	UTSW	17	85985454	missense	possibly damaging	0.63
R8720:Srbd1	UTSW	17	86051143	missense	probably damaging	1.00
R8839:Srbd1	UTSW	17	85988421	missense	probably benign
R8899:Srbd1	UTSW	17	85985457	missense
R8905:Srbd1	UTSW	17	86001462	missense	probably benign	0.00
R9051:Srbd1	UTSW	17	86120687	missense	possibly damaging	0.70
R9402:Srbd1	UTSW	17	86099277	missense	probably benign	0.26
R9701:Srbd1	UTSW	17	86126131	missense	probably damaging	1.00
R9729:Srbd1	UTSW	17	86130122	missense	probably benign
R9733:Srbd1	UTSW	17	86115283	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTCTTGCACACATTTCCACAGGCG -3'
(R):5'- CAGCTTACTCTTGGTTTTCTGGCACAT -3'

Sequencing Primer
(F):5'- CGCTTGTTGAGGGGGTC -3'
(R):5'- ctcctttacccactcatctcc -3'

Posted On

2013-07-30