Mutagenetix > Incidental Mutation

Incidental Mutation 'R8167:Gli3'

633864

Institutional Source

Beutler Lab

Gene Symbol

Gli3

Ensembl Gene

ENSMUSG00000021318

Gene Name

GLI-Kruppel family member GLI3

Synonyms

brachyphalangy, Bph

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8167 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

15463235-15730026 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 15725643 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 1205 (L1205R)

Ref Sequence

ENSEMBL: ENSMUSP00000106137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110510]

AlphaFold

Q61602

Predicted Effect

probably benign
Transcript: ENSMUST00000110510
AA Change: L1205R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: L1205R

Domain	Start	End	E-Value	Type
low complexity region	120	136	N/A	INTRINSIC
low complexity region	204	220	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
low complexity region	403	421	N/A	INTRINSIC
ZnF_C2H2	480	505	1.53e-1	SMART
ZnF_C2H2	513	540	1.23e0	SMART
ZnF_C2H2	546	570	3.16e-3	SMART
ZnF_C2H2	576	601	4.17e-3	SMART
ZnF_C2H2	607	632	1.4e-4	SMART
low complexity region	703	726	N/A	INTRINSIC
low complexity region	756	763	N/A	INTRINSIC
low complexity region	849	880	N/A	INTRINSIC
low complexity region	934	944	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1081	1095	N/A	INTRINSIC
low complexity region	1166	1175	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415O20Rik	A	G	15: 98,588,667	H106R	probably benign	Het
4931406B18Rik	T	A	7: 43,497,864	I315F	possibly damaging	Het
A430078G23Rik	A	T	8: 3,353,636		probably benign	Het
Acin1	G	A	14: 54,664,880	T485I	probably benign	Het
Adamts2	A	T	11: 50,779,714	I552F	probably damaging	Het
Anapc11	T	A	11: 120,599,286	N9K	probably benign	Het
Atp9b	T	C	18: 80,847,183	T314A		Het
Birc6	T	A	17: 74,643,394	I3214N	probably damaging	Het
Catsperb	A	G	12: 101,591,455	I762V	probably benign	Het
Cblb	T	A	16: 52,166,002	M536K	probably benign	Het
Ccdc85c	C	A	12: 108,274,500	A212S	unknown	Het
Cdh23	T	A	10: 60,314,383	D2561V	probably benign	Het
Cdh23	T	A	10: 60,337,693	Y1672F	probably damaging	Het
Cep83	T	C	10: 94,728,717	S173P	possibly damaging	Het
Ctc1	C	T	11: 69,027,758	P530S	probably damaging	Het
D630045J12Rik	A	G	6: 38,190,549		probably null	Het
Dnah7b	A	T	1: 46,253,511	I3019F	possibly damaging	Het
Dsc1	T	C	18: 20,097,201	D349G	probably damaging	Het
Ehd2	C	G	7: 15,963,992	G107R	probably damaging	Het
Epha3	A	T	16: 63,568,441	W816R	probably damaging	Het
Fam135b	T	A	15: 71,532,991	S69C	probably null	Het
Fbxo43	A	G	15: 36,151,771	F600S	probably damaging	Het
Flnc	A	T	6: 29,455,922	D2117V	probably damaging	Het
Gas2l3	T	A	10: 89,426,480	T127S	probably damaging	Het
Gm17093	A	T	14: 44,520,682	I107F		Het
Gm7298	T	A	6: 121,784,455	C1323*	probably null	Het
Gm8298	T	A	3: 59,877,211	D368E	probably benign	Het
H2-D1	A	G	17: 35,266,765	T89A		Het
Hira	T	G	16: 18,896,509	D52E	probably benign	Het
Ighv6-6	G	C	12: 114,434,905	Y80*	probably null	Het
Kat6b	C	T	14: 21,669,885	T1435I	probably damaging	Het
Kcna1	C	A	6: 126,643,480		probably benign	Het
Kif24	C	A	4: 41,392,957	R1284L	possibly damaging	Het
Kremen2	A	C	17: 23,743,340	C173G	probably damaging	Het
Krtap24-1	G	C	16: 88,611,819	Q140E	probably benign	Het
Lrrc66	C	A	5: 73,629,609	G133*	probably null	Het
Mast1	C	A	8: 84,921,358	R498L	probably damaging	Het
Myom3	T	C	4: 135,807,193	I1231T	possibly damaging	Het
Nid2	G	A	14: 19,810,063	V1350I	possibly damaging	Het
Olfr1062	A	G	2: 86,423,140	C179R	probably damaging	Het
Olfr1312	A	T	2: 112,042,444	V196D	possibly damaging	Het
Olfr823	T	C	10: 130,112,481	Q103R	probably damaging	Het
Pde4a	A	G	9: 21,206,173	D577G	possibly damaging	Het
Pde4d	T	A	13: 109,442,321	N36K	probably benign	Het
Plekhg1	A	T	10: 3,957,452	S845C		Het
Plekhg1	G	A	10: 3,957,453	S845N		Het
Plod1	C	T	4: 147,920,201	D481N	probably damaging	Het
Plxna4	T	A	6: 32,517,046	M212L	probably damaging	Het
Ppip5k1	C	A	2: 121,342,801	E464*	probably null	Het
Raph1	T	A	1: 60,490,111	M664L	unknown	Het
Rbm11	A	C	16: 75,598,785	M115L	probably benign	Het
Rerg	T	C	6: 137,057,871	H45R	possibly damaging	Het
Rnf43	A	G	11: 87,727,406	E47G	probably benign	Het
Rsph1	A	G	17: 31,277,286		probably benign	Het
Safb	A	G	17: 56,585,286	E42G	unknown	Het
Scn1a	A	T	2: 66,324,838	D592E	probably damaging	Het
Sdf4	T	G	4: 156,008,922	V237G	possibly damaging	Het
Slc44a2	C	A	9: 21,346,772	H439Q	possibly damaging	Het
Smg7	A	T	1: 152,844,372	N761K	possibly damaging	Het
Snrpb2	A	G	2: 143,068,364	E114G	probably benign	Het
Ssh1	T	C	5: 113,951,990	D346G	possibly damaging	Het
Svopl	T	A	6: 38,017,044	I351F	probably damaging	Het
Tgfb2	A	G	1: 186,690,745	S136P	possibly damaging	Het
Thsd7a	A	T	6: 12,317,401	L1636*	probably null	Het
Tmc2	A	G	2: 130,241,568	T482A	probably benign	Het
Tnk2	C	A	16: 32,680,262	P798T	probably damaging	Het
Trim5	T	C	7: 104,278,423	Y170C	probably damaging	Het
Ttll10	T	C	4: 156,044,756	M310V	probably null	Het
Unc13c	T	A	9: 73,736,703	T1160S	probably damaging	Het
Usp25	A	T	16: 77,107,931	D795V	probably damaging	Het
Usp28	T	A	9: 49,037,848	V914E	probably damaging	Het
Utrn	A	T	10: 12,671,814	C1627*	probably null	Het
Vmn1r28	C	A	6: 58,266,067	F298L	noncoding transcript	Het
Vps29	T	C	5: 122,362,814	S69P	possibly damaging	Het
Zfp703	T	A	8: 26,979,754	L482H	probably damaging	Het

Other mutations in Gli3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Gli3	APN	13	15644299	missense	probably damaging	1.00
IGL00471:Gli3	APN	13	15723769	critical splice donor site	probably null
IGL00484:Gli3	APN	13	15644392	missense	possibly damaging	0.84
IGL00588:Gli3	APN	13	15644392	missense	possibly damaging	0.84
IGL01161:Gli3	APN	13	15548398	critical splice acceptor site	probably null
IGL01633:Gli3	APN	13	15648634	missense	probably damaging	1.00
IGL01799:Gli3	APN	13	15726161	missense	probably benign	0.00
IGL01861:Gli3	APN	13	15725325	missense	probably damaging	1.00
IGL02063:Gli3	APN	13	15726372	missense	possibly damaging	0.94
IGL02112:Gli3	APN	13	15662514	missense	probably damaging	1.00
IGL02255:Gli3	APN	13	15648719	missense	probably damaging	1.00
IGL02270:Gli3	APN	13	15726786	utr 3 prime	probably benign
IGL02336:Gli3	APN	13	15720289	missense	probably damaging	1.00
IGL02346:Gli3	APN	13	15723693	missense	probably damaging	1.00
IGL02744:Gli3	APN	13	15613886	critical splice donor site	probably null
IGL02877:Gli3	APN	13	15724742	missense	probably damaging	1.00
IGL02975:Gli3	APN	13	15724568	missense	probably damaging	1.00
IGL03018:Gli3	APN	13	15660132	missense	probably damaging	1.00
IGL03378:Gli3	APN	13	15644420	missense	probably damaging	1.00
IGL03406:Gli3	APN	13	15648581	missense	probably damaging	1.00
Capone	UTSW	13	15715034	missense	probably damaging	1.00
Carpals	UTSW	13	15713650	critical splice donor site	probably null
Ness	UTSW	13	15723555	missense	probably damaging	1.00
FR4737:Gli3	UTSW	13	15644357	missense	probably damaging	1.00
R0110:Gli3	UTSW	13	15724785	missense	probably damaging	1.00
R0329:Gli3	UTSW	13	15723558	missense	probably damaging	0.98
R0330:Gli3	UTSW	13	15723558	missense	probably damaging	0.98
R0360:Gli3	UTSW	13	15724764	missense	probably benign	0.32
R0364:Gli3	UTSW	13	15724764	missense	probably benign	0.32
R0469:Gli3	UTSW	13	15724785	missense	probably damaging	1.00
R0616:Gli3	UTSW	13	15662406	missense	possibly damaging	0.75
R0639:Gli3	UTSW	13	15724715	missense	probably damaging	1.00
R1072:Gli3	UTSW	13	15713605	missense	probably damaging	1.00
R1257:Gli3	UTSW	13	15725996	nonsense	probably null
R1270:Gli3	UTSW	13	15723744	missense	probably benign	0.02
R1424:Gli3	UTSW	13	15726314	missense	probably benign	0.00
R1481:Gli3	UTSW	13	15613850	missense	probably damaging	0.99
R1596:Gli3	UTSW	13	15725471	missense	possibly damaging	0.74
R1628:Gli3	UTSW	13	15726312	missense	probably benign	0.00
R1721:Gli3	UTSW	13	15726297	missense	probably benign	0.27
R1797:Gli3	UTSW	13	15713512	missense	probably damaging	0.99
R1813:Gli3	UTSW	13	15648691	missense	probably damaging	1.00
R1819:Gli3	UTSW	13	15725792	nonsense	probably null
R1988:Gli3	UTSW	13	15726380	missense	probably benign
R2132:Gli3	UTSW	13	15725549	missense	possibly damaging	0.74
R2352:Gli3	UTSW	13	15662392	missense	probably benign	0.02
R3085:Gli3	UTSW	13	15660941	missense	probably damaging	1.00
R3177:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R3277:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R4162:Gli3	UTSW	13	15725115	missense	possibly damaging	0.93
R4497:Gli3	UTSW	13	15723571	missense	possibly damaging	0.74
R4526:Gli3	UTSW	13	15713631	missense	probably damaging	1.00
R4979:Gli3	UTSW	13	15724464	missense	possibly damaging	0.87
R5327:Gli3	UTSW	13	15548507	missense	probably damaging	0.99
R5395:Gli3	UTSW	13	15714950	missense	probably damaging	1.00
R5494:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R5609:Gli3	UTSW	13	15548453	missense	possibly damaging	0.82
R5718:Gli3	UTSW	13	15478165	critical splice donor site	probably null
R5810:Gli3	UTSW	13	15644309	missense	probably damaging	0.99
R5896:Gli3	UTSW	13	15726180	missense	probably benign	0.00
R5930:Gli3	UTSW	13	15548625	missense	probably damaging	1.00
R5964:Gli3	UTSW	13	15726162	nonsense	probably null
R5985:Gli3	UTSW	13	15723555	missense	probably damaging	1.00
R6224:Gli3	UTSW	13	15725145	missense	probably benign
R6278:Gli3	UTSW	13	15725113	missense	possibly damaging	0.69
R6330:Gli3	UTSW	13	15724732	missense	probably damaging	1.00
R6383:Gli3	UTSW	13	15723555	missense	probably damaging	1.00
R6523:Gli3	UTSW	13	15713650	critical splice donor site	probably null
R7072:Gli3	UTSW	13	15725695	missense	possibly damaging	0.51
R7085:Gli3	UTSW	13	15715062	missense	probably damaging	1.00
R7228:Gli3	UTSW	13	15724502	missense	probably benign	0.00
R7327:Gli3	UTSW	13	15725559	missense	probably benign	0.02
R7451:Gli3	UTSW	13	15726291	missense	possibly damaging	0.50
R7974:Gli3	UTSW	13	15726256	missense	probably benign	0.00
R8170:Gli3	UTSW	13	15720208	missense	probably benign
R8199:Gli3	UTSW	13	15725991	missense	probably benign	0.08
R8247:Gli3	UTSW	13	15726775	missense	possibly damaging	0.82
R8332:Gli3	UTSW	13	15713548	missense	possibly damaging	0.58
R8347:Gli3	UTSW	13	15723525	missense	probably damaging	1.00
R8559:Gli3	UTSW	13	15660132	missense	probably damaging	1.00
R8676:Gli3	UTSW	13	15715034	missense	probably damaging	1.00
R8905:Gli3	UTSW	13	15726531	missense	probably benign	0.01
R9099:Gli3	UTSW	13	15726735	missense	probably damaging	1.00
R9260:Gli3	UTSW	13	15725090	missense	probably damaging	0.99
R9317:Gli3	UTSW	13	15715073	missense	probably damaging	1.00
R9475:Gli3	UTSW	13	15725711	missense	possibly damaging	0.87
R9546:Gli3	UTSW	13	15613858	missense	probably benign	0.00
R9571:Gli3	UTSW	13	15726273	missense	probably benign	0.00
R9621:Gli3	UTSW	13	15726668	missense	probably benign	0.01
R9704:Gli3	UTSW	13	15723473	missense	probably damaging	1.00
R9787:Gli3	UTSW	13	15725801	missense	probably damaging	0.96
RF010:Gli3	UTSW	13	15726369	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCTCTGAGGGCAGTAAAAC -3'
(R):5'- TTGGACCCTTGAATCCCTGTAC -3'

Sequencing Primer
(F):5'- GTAAAACTGATTTGCCCATCCAGTGG -3'
(R):5'- CTGTACCACAGGCATGATCTAGAG -3'

Posted On

2020-07-13