Incidental Mutation 'R8167:Cblb'
ID633875
Institutional Source Beutler Lab
Gene Symbol Cblb
Ensembl Gene ENSMUSG00000022637
Gene NameCasitas B-lineage lymphoma b
SynonymsCbl-b
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R8167 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location52031225-52208048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52166002 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 536 (M536K)
Ref Sequence ENSEMBL: ENSMUSP00000110115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114471]
Predicted Effect probably benign
Transcript: ENSMUST00000114471
AA Change: M536K

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637
AA Change: M536K

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
Pfam:Cbl_N 41 167 1.5e-58 PFAM
Pfam:Cbl_N2 171 254 2.9e-43 PFAM
SH2 257 354 3.22e0 SMART
RING 373 411 1.04e-7 SMART
low complexity region 447 454 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 666 682 N/A INTRINSIC
low complexity region 773 783 N/A INTRINSIC
low complexity region 792 804 N/A INTRINSIC
low complexity region 857 871 N/A INTRINSIC
UBA 888 925 4.06e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik A G 15: 98,588,667 H106R probably benign Het
4931406B18Rik T A 7: 43,497,864 I315F possibly damaging Het
A430078G23Rik A T 8: 3,353,636 probably benign Het
Acin1 G A 14: 54,664,880 T485I probably benign Het
Adamts2 A T 11: 50,779,714 I552F probably damaging Het
Anapc11 T A 11: 120,599,286 N9K probably benign Het
Atp9b T C 18: 80,847,183 T314A Het
Birc6 T A 17: 74,643,394 I3214N probably damaging Het
Catsperb A G 12: 101,591,455 I762V probably benign Het
Ccdc85c C A 12: 108,274,500 A212S unknown Het
Cdh23 T A 10: 60,314,383 D2561V probably benign Het
Cdh23 T A 10: 60,337,693 Y1672F probably damaging Het
Cep83 T C 10: 94,728,717 S173P possibly damaging Het
Ctc1 C T 11: 69,027,758 P530S probably damaging Het
D630045J12Rik A G 6: 38,190,549 probably null Het
Dnah7b A T 1: 46,253,511 I3019F possibly damaging Het
Dsc1 T C 18: 20,097,201 D349G probably damaging Het
Ehd2 C G 7: 15,963,992 G107R probably damaging Het
Epha3 A T 16: 63,568,441 W816R probably damaging Het
Fam135b T A 15: 71,532,991 S69C probably null Het
Fbxo43 A G 15: 36,151,771 F600S probably damaging Het
Flnc A T 6: 29,455,922 D2117V probably damaging Het
Gas2l3 T A 10: 89,426,480 T127S probably damaging Het
Gli3 T G 13: 15,725,643 L1205R probably benign Het
Gm17093 A T 14: 44,520,682 I107F Het
Gm7298 T A 6: 121,784,455 C1323* probably null Het
Gm8298 T A 3: 59,877,211 D368E probably benign Het
H2-D1 A G 17: 35,266,765 T89A Het
Hira T G 16: 18,896,509 D52E probably benign Het
Ighv6-6 G C 12: 114,434,905 Y80* probably null Het
Kat6b C T 14: 21,669,885 T1435I probably damaging Het
Kcna1 C A 6: 126,643,480 probably benign Het
Kif24 C A 4: 41,392,957 R1284L possibly damaging Het
Kremen2 A C 17: 23,743,340 C173G probably damaging Het
Krtap24-1 G C 16: 88,611,819 Q140E probably benign Het
Lrrc66 C A 5: 73,629,609 G133* probably null Het
Mast1 C A 8: 84,921,358 R498L probably damaging Het
Myom3 T C 4: 135,807,193 I1231T possibly damaging Het
Nid2 G A 14: 19,810,063 V1350I possibly damaging Het
Olfr1062 A G 2: 86,423,140 C179R probably damaging Het
Olfr1312 A T 2: 112,042,444 V196D possibly damaging Het
Olfr823 T C 10: 130,112,481 Q103R probably damaging Het
Pde4a A G 9: 21,206,173 D577G possibly damaging Het
Pde4d T A 13: 109,442,321 N36K probably benign Het
Plekhg1 A T 10: 3,957,452 S845C Het
Plekhg1 G A 10: 3,957,453 S845N Het
Plod1 C T 4: 147,920,201 D481N probably damaging Het
Plxna4 T A 6: 32,517,046 M212L probably damaging Het
Ppip5k1 C A 2: 121,342,801 E464* probably null Het
Raph1 T A 1: 60,490,111 M664L unknown Het
Rbm11 A C 16: 75,598,785 M115L probably benign Het
Rerg T C 6: 137,057,871 H45R possibly damaging Het
Rnf43 A G 11: 87,727,406 E47G probably benign Het
Rsph1 A G 17: 31,277,286 probably benign Het
Safb A G 17: 56,585,286 E42G unknown Het
Scn1a A T 2: 66,324,838 D592E probably damaging Het
Sdf4 T G 4: 156,008,922 V237G possibly damaging Het
Slc44a2 C A 9: 21,346,772 H439Q possibly damaging Het
Smg7 A T 1: 152,844,372 N761K possibly damaging Het
Snrpb2 A G 2: 143,068,364 E114G probably benign Het
Ssh1 T C 5: 113,951,990 D346G possibly damaging Het
Svopl T A 6: 38,017,044 I351F probably damaging Het
Tgfb2 A G 1: 186,690,745 S136P possibly damaging Het
Thsd7a A T 6: 12,317,401 L1636* probably null Het
Tmc2 A G 2: 130,241,568 T482A probably benign Het
Tnk2 C A 16: 32,680,262 P798T probably damaging Het
Trim5 T C 7: 104,278,423 Y170C probably damaging Het
Ttll10 T C 4: 156,044,756 M310V probably null Het
Unc13c T A 9: 73,736,703 T1160S probably damaging Het
Usp25 A T 16: 77,107,931 D795V probably damaging Het
Usp28 T A 9: 49,037,848 V914E probably damaging Het
Utrn A T 10: 12,671,814 C1627* probably null Het
Vmn1r28 C A 6: 58,266,067 F298L noncoding transcript Het
Vps29 T C 5: 122,362,814 S69P possibly damaging Het
Zfp703 T A 8: 26,979,754 L482H probably damaging Het
Other mutations in Cblb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Cblb APN 16 52183307 missense probably benign 0.28
IGL00927:Cblb APN 16 52166098 missense probably benign
IGL01108:Cblb APN 16 52047451 critical splice donor site probably null
IGL01336:Cblb APN 16 52186229 missense probably benign 0.00
IGL01943:Cblb APN 16 52139633 splice site probably null
IGL02273:Cblb APN 16 52047294 missense possibly damaging 0.95
IGL02405:Cblb APN 16 52166253 missense probably benign 0.32
IGL02445:Cblb APN 16 52166305 missense probably damaging 1.00
IGL02728:Cblb APN 16 52183309 missense probably benign 0.04
IGL03000:Cblb APN 16 52204542 missense probably damaging 1.00
PIT4362001:Cblb UTSW 16 52139542 nonsense probably null
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0294:Cblb UTSW 16 52135824 missense probably damaging 1.00
R0403:Cblb UTSW 16 52152626 missense probably benign 0.23
R0506:Cblb UTSW 16 52204480 missense probably benign 0.25
R1172:Cblb UTSW 16 52186240 splice site probably benign
R1245:Cblb UTSW 16 52047187 splice site probably benign
R1443:Cblb UTSW 16 52139611 missense possibly damaging 0.95
R1549:Cblb UTSW 16 52033010 splice site probably benign
R1568:Cblb UTSW 16 52135829 missense probably damaging 1.00
R1734:Cblb UTSW 16 52186240 splice site probably benign
R2107:Cblb UTSW 16 52152716 critical splice donor site probably null
R2231:Cblb UTSW 16 52194272 missense probably benign 0.00
R4419:Cblb UTSW 16 52047258 missense possibly damaging 0.80
R4913:Cblb UTSW 16 52166029 missense possibly damaging 0.78
R4940:Cblb UTSW 16 52033103 missense probably damaging 1.00
R5159:Cblb UTSW 16 52112120 missense probably damaging 0.97
R5318:Cblb UTSW 16 52186198 missense possibly damaging 0.88
R5367:Cblb UTSW 16 52204653 missense probably damaging 1.00
R5432:Cblb UTSW 16 52142865 missense probably damaging 1.00
R5490:Cblb UTSW 16 52174370 missense possibly damaging 0.52
R5618:Cblb UTSW 16 52152668 missense possibly damaging 0.89
R6047:Cblb UTSW 16 52112248 critical splice donor site probably null
R6152:Cblb UTSW 16 52141056 missense probably damaging 0.98
R6667:Cblb UTSW 16 52152644 missense possibly damaging 0.81
R6914:Cblb UTSW 16 52047430 missense probably damaging 1.00
R7681:Cblb UTSW 16 52204638 missense probably damaging 0.96
R8236:Cblb UTSW 16 52166029 missense possibly damaging 0.85
X0011:Cblb UTSW 16 52152629 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGTCTCTGGAATCACAGGAG -3'
(R):5'- CATCACCTGGTTAGTCCCGAAG -3'

Sequencing Primer
(F):5'- GTCTCTGGAATCACAGGAGTTTAC -3'
(R):5'- AAGGCATCCCGAGGGCAC -3'
Posted On2020-07-13