Incidental Mutation 'R8168:Gzf1'
ID633894
Institutional Source Beutler Lab
Gene Symbol Gzf1
Ensembl Gene ENSMUSG00000027439
Gene NameGDNF-inducible zinc finger protein 1
SynonymsZfp336, 8430437G08Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_028986.3; MGI:1921783

Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R8168 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location148681023-148692949 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 148684766 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 386 (R386C)
Ref Sequence ENSEMBL: ENSMUSP00000028928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028928] [ENSMUST00000131292]
Predicted Effect probably damaging
Transcript: ENSMUST00000028928
AA Change: R386C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028928
Gene: ENSMUSG00000027439
AA Change: R386C

DomainStartEndE-ValueType
BTB 31 133 2.01e-20 SMART
low complexity region 199 213 N/A INTRINSIC
coiled coil region 287 308 N/A INTRINSIC
ZnF_C2H2 315 337 6.32e-3 SMART
ZnF_C2H2 346 369 1.2e-3 SMART
ZnF_C2H2 375 398 8.34e-3 SMART
ZnF_C2H2 405 427 7.78e-3 SMART
ZnF_C2H2 433 455 1.69e-3 SMART
ZnF_C2H2 461 483 1.43e-1 SMART
ZnF_C2H2 489 511 2.4e-3 SMART
ZnF_C2H2 517 539 1.47e-3 SMART
ZnF_C2H2 545 567 1.38e-3 SMART
ZnF_C2H2 573 595 1.04e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131292
SMART Domains Protein: ENSMUSP00000121799
Gene: ENSMUSG00000027439

DomainStartEndE-ValueType
BTB 31 133 2.01e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
9430020K01Rik A T 18: 4,675,094 D952V probably benign Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Atp6v1b2 T C 8: 69,108,331 S404P possibly damaging Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
D230025D16Rik C T 8: 105,248,769 P330L probably benign Het
Dock5 A T 14: 67,770,197 probably null Het
Flrt1 G A 19: 7,096,637 L182F probably damaging Het
Foxf1 T C 8: 121,085,162 V255A probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
H2-Aa T A 17: 34,287,721 T16S possibly damaging Het
Hdgfrp2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mrgprb2 A T 7: 48,552,019 S319R probably benign Het
Mtrr C T 13: 68,572,613 V288I probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nelfa A T 5: 33,921,907 N107K possibly damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prdm10 G A 9: 31,346,967 A514T probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Ptp4a3 T G 15: 73,756,846 Y152D probably damaging Het
Raph1 A G 1: 60,499,620 C389R unknown Het
Rcc1 T C 4: 132,335,785 E170G probably benign Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tex40 A G 19: 6,922,652 S162P possibly damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vmn1r174 A T 7: 23,754,671 D254V probably damaging Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in Gzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Gzf1 APN 2 148690996 missense probably damaging 0.99
IGL01647:Gzf1 APN 2 148683650 missense probably damaging 1.00
IGL01789:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01791:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01952:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01954:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01956:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL03391:Gzf1 APN 2 148683683 missense probably damaging 1.00
I0000:Gzf1 UTSW 2 148686620 unclassified probably benign
P0019:Gzf1 UTSW 2 148683980 missense probably damaging 1.00
R0420:Gzf1 UTSW 2 148683833 missense probably benign 0.30
R0725:Gzf1 UTSW 2 148684649 nonsense probably null
R1131:Gzf1 UTSW 2 148690867 missense probably benign 0.02
R2000:Gzf1 UTSW 2 148684611 missense probably benign 0.16
R2211:Gzf1 UTSW 2 148684950 missense probably damaging 1.00
R2251:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R2252:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R2253:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R4233:Gzf1 UTSW 2 148686533 missense possibly damaging 0.86
R5551:Gzf1 UTSW 2 148684328 missense probably damaging 1.00
R6050:Gzf1 UTSW 2 148684238 missense possibly damaging 0.89
R6891:Gzf1 UTSW 2 148684769 nonsense probably null
R7457:Gzf1 UTSW 2 148690082 missense probably damaging 0.99
R7735:Gzf1 UTSW 2 148688163 missense possibly damaging 0.91
R7839:Gzf1 UTSW 2 148683895 nonsense probably null
R8225:Gzf1 UTSW 2 148690844 missense probably benign 0.02
R8432:Gzf1 UTSW 2 148690195 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGACAAGGCCTTCCTGTACGAG -3'
(R):5'- CCTCAGGTGGGTTTTAAGAGC -3'

Sequencing Primer
(F):5'- GCCTTCCTGTACGAGAAGAGTTTC -3'
(R):5'- GATGGCTGTGAGAACTTGGCATC -3'
Posted On2020-07-13