Incidental Mutation 'R8168:Rcc1'
ID633899
Institutional Source Beutler Lab
Gene Symbol Rcc1
Ensembl Gene ENSMUSG00000028896
Gene Nameregulator of chromosome condensation 1
SynonymsChc1, 4931417M11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R8168 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location132331919-132353605 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132335785 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 170 (E170G)
Ref Sequence ENSEMBL: ENSMUSP00000030726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030726] [ENSMUST00000084250] [ENSMUST00000105951] [ENSMUST00000155129]
Predicted Effect probably benign
Transcript: ENSMUST00000030726
AA Change: E170G

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030726
Gene: ENSMUSG00000028896
AA Change: E170G

DomainStartEndE-ValueType
Pfam:RCC1 47 95 7.9e-12 PFAM
Pfam:RCC1 98 147 7.5e-17 PFAM
Pfam:RCC1_2 134 165 1.3e-11 PFAM
Pfam:RCC1 150 200 9.9e-10 PFAM
Pfam:RCC1_2 187 216 3.2e-7 PFAM
Pfam:RCC1 203 268 4.2e-14 PFAM
Pfam:RCC1 271 322 1.1e-11 PFAM
Pfam:RCC1 325 373 3.4e-10 PFAM
Pfam:RCC1 376 427 3.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084250
AA Change: E157G

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081271
Gene: ENSMUSG00000028896
AA Change: E157G

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 4.1e-10 PFAM
Pfam:RCC1 85 134 1.4e-13 PFAM
Pfam:RCC1_2 121 151 1.5e-8 PFAM
Pfam:RCC1 137 187 1.7e-7 PFAM
Pfam:RCC1_2 174 203 3e-5 PFAM
Pfam:RCC1 190 255 9.6e-11 PFAM
Pfam:RCC1 258 309 1.9e-9 PFAM
Pfam:RCC1 312 360 5.7e-9 PFAM
Pfam:RCC1 363 414 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105951
AA Change: E157G

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101571
Gene: ENSMUSG00000028896
AA Change: E157G

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 4.1e-10 PFAM
Pfam:RCC1 85 134 1.4e-13 PFAM
Pfam:RCC1_2 121 151 1.5e-8 PFAM
Pfam:RCC1 137 187 1.7e-7 PFAM
Pfam:RCC1_2 174 203 3e-5 PFAM
Pfam:RCC1 190 255 9.6e-11 PFAM
Pfam:RCC1 258 309 1.9e-9 PFAM
Pfam:RCC1 312 360 5.7e-9 PFAM
Pfam:RCC1 363 414 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155129
SMART Domains Protein: ENSMUSP00000120701
Gene: ENSMUSG00000028896

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 3.9e-13 PFAM
Pfam:RCC1_2 69 98 5.2e-7 PFAM
Pfam:RCC1 85 116 5.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
9430020K01Rik A T 18: 4,675,094 D952V probably benign Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Atp6v1b2 T C 8: 69,108,331 S404P possibly damaging Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
D230025D16Rik C T 8: 105,248,769 P330L probably benign Het
Dock5 A T 14: 67,770,197 probably null Het
Flrt1 G A 19: 7,096,637 L182F probably damaging Het
Foxf1 T C 8: 121,085,162 V255A probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
Gzf1 C T 2: 148,684,766 R386C probably damaging Het
H2-Aa T A 17: 34,287,721 T16S possibly damaging Het
Hdgfrp2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mrgprb2 A T 7: 48,552,019 S319R probably benign Het
Mtrr C T 13: 68,572,613 V288I probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nelfa A T 5: 33,921,907 N107K possibly damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prdm10 G A 9: 31,346,967 A514T probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Ptp4a3 T G 15: 73,756,846 Y152D probably damaging Het
Raph1 A G 1: 60,499,620 C389R unknown Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tex40 A G 19: 6,922,652 S162P possibly damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vmn1r174 A T 7: 23,754,671 D254V probably damaging Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in Rcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02881:Rcc1 APN 4 132337756 missense probably benign 0.20
IGL02927:Rcc1 APN 4 132337756 missense probably benign 0.20
IGL02802:Rcc1 UTSW 4 132337756 missense probably benign 0.20
IGL02837:Rcc1 UTSW 4 132337756 missense probably benign 0.20
R0240:Rcc1 UTSW 4 132332915 missense probably damaging 1.00
R0240:Rcc1 UTSW 4 132332915 missense probably damaging 1.00
R0828:Rcc1 UTSW 4 132335825 unclassified probably benign
R1606:Rcc1 UTSW 4 132334776 splice site probably null
R2155:Rcc1 UTSW 4 132338049 critical splice donor site probably null
R3721:Rcc1 UTSW 4 132337814 missense possibly damaging 0.46
R4633:Rcc1 UTSW 4 132335769 missense probably damaging 0.98
R4908:Rcc1 UTSW 4 132337753 missense probably damaging 1.00
R4936:Rcc1 UTSW 4 132335735 missense probably damaging 0.96
R5461:Rcc1 UTSW 4 132334186 missense probably benign 0.00
R5627:Rcc1 UTSW 4 132338143 missense probably damaging 0.98
R6088:Rcc1 UTSW 4 132332842 missense probably benign 0.00
R6197:Rcc1 UTSW 4 132337762 missense possibly damaging 0.58
R6456:Rcc1 UTSW 4 132334116 missense probably benign 0.10
R7127:Rcc1 UTSW 4 132334796 missense probably damaging 0.98
R7440:Rcc1 UTSW 4 132337799 missense probably damaging 0.97
R7529:Rcc1 UTSW 4 132334563 missense probably benign 0.00
R8469:Rcc1 UTSW 4 132334134 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCTAAGACCCAAGGCTGAAC -3'
(R):5'- CGCAGACTCTGGACATTTCC -3'

Sequencing Primer
(F):5'- TACCAGCCAGCTCCTGC -3'
(R):5'- CATTCTTCAGGATTTCCATGTGTGGC -3'
Posted On2020-07-13