Incidental Mutation 'R8168:Nelfa'
ID633900
Institutional Source Beutler Lab
Gene Symbol Nelfa
Ensembl Gene ENSMUSG00000029111
Gene Namenegative elongation factor complex member A, Whsc2
SynonymsWhsc2, Nelf-A, Whsc2h
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8168 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location33897916-33936413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33921907 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 107 (N107K)
Ref Sequence ENSEMBL: ENSMUSP00000030993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030993]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030993
AA Change: N107K

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030993
Gene: ENSMUSG00000029111
AA Change: N107K

DomainStartEndE-ValueType
low complexity region 54 63 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 315 333 N/A INTRINSIC
low complexity region 339 365 N/A INTRINSIC
low complexity region 383 429 N/A INTRINSIC
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed ubiquitously with higher levels in fetal than in adult tissues. It encodes a protein sharing 93% sequence identity with the mouse protein. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene is mapped to the 165 kb WHS critical region, and may play a role in the phenotype of the WHS or Pitt-Rogers-Danks syndrome. The encoded protein is found to be capable of reacting with HLA-A2-restricted and tumor-specific cytotoxic T lymphocytes, suggesting a target for use in specific immunotherapy for a large number of cancer patients. This protein has also been shown to be a member of the NELF (negative elongation factor) protein complex that participates in the regulation of RNA polymerase II transcription elongation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
9430020K01Rik A T 18: 4,675,094 D952V probably benign Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Atp6v1b2 T C 8: 69,108,331 S404P possibly damaging Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
D230025D16Rik C T 8: 105,248,769 P330L probably benign Het
Dock5 A T 14: 67,770,197 probably null Het
Flrt1 G A 19: 7,096,637 L182F probably damaging Het
Foxf1 T C 8: 121,085,162 V255A probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
Gzf1 C T 2: 148,684,766 R386C probably damaging Het
H2-Aa T A 17: 34,287,721 T16S possibly damaging Het
Hdgfrp2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mrgprb2 A T 7: 48,552,019 S319R probably benign Het
Mtrr C T 13: 68,572,613 V288I probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prdm10 G A 9: 31,346,967 A514T probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Ptp4a3 T G 15: 73,756,846 Y152D probably damaging Het
Raph1 A G 1: 60,499,620 C389R unknown Het
Rcc1 T C 4: 132,335,785 E170G probably benign Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tex40 A G 19: 6,922,652 S162P possibly damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vmn1r174 A T 7: 23,754,671 D254V probably damaging Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in Nelfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Nelfa APN 5 33898802 missense probably damaging 0.98
R0590:Nelfa UTSW 5 33901825 missense probably damaging 1.00
R0613:Nelfa UTSW 5 33903463 splice site probably benign
R1533:Nelfa UTSW 5 33898871 missense probably damaging 0.98
R2181:Nelfa UTSW 5 33900509 missense probably benign 0.43
R4246:Nelfa UTSW 5 33899029 missense probably damaging 1.00
R4398:Nelfa UTSW 5 33901279 missense possibly damaging 0.66
R4657:Nelfa UTSW 5 33901813 missense probably benign 0.08
R4973:Nelfa UTSW 5 33901818 missense probably benign 0.04
R5424:Nelfa UTSW 5 33921845 critical splice donor site probably null
R5614:Nelfa UTSW 5 33920500 missense probably damaging 1.00
R5737:Nelfa UTSW 5 33899113 critical splice acceptor site probably null
R6135:Nelfa UTSW 5 33899276 splice site probably null
R6153:Nelfa UTSW 5 33898879 missense probably damaging 1.00
R7231:Nelfa UTSW 5 33898825 missense probably damaging 1.00
R8175:Nelfa UTSW 5 33922013 missense possibly damaging 0.86
R8446:Nelfa UTSW 5 33901638 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGTATAAGGAGCCATGGC -3'
(R):5'- GGAAGCATAGGCACAGTCTG -3'

Sequencing Primer
(F):5'- TGTATAAGGAGCCATGGCATACTAC -3'
(R):5'- CAGGGGACATTTTAAGCTGTCAC -3'
Posted On2020-07-13