Incidental Mutation 'R8168:Vmn1r174'
ID633903
Institutional Source Beutler Lab
Gene Symbol Vmn1r174
Ensembl Gene ENSMUSG00000090411
Gene Namevomeronasal 1 receptor 174
SynonymsV1rd22
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8168 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location23752270-23762403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23754671 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 254 (D254V)
Ref Sequence ENSEMBL: ENSMUSP00000126478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167551]
Predicted Effect probably damaging
Transcript: ENSMUST00000167551
AA Change: D254V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126478
Gene: ENSMUSG00000090411
AA Change: D254V

DomainStartEndE-ValueType
Pfam:TAS2R 8 300 4e-9 PFAM
Pfam:V1R 43 300 5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
9430020K01Rik A T 18: 4,675,094 D952V probably benign Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Atp6v1b2 T C 8: 69,108,331 S404P possibly damaging Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
D230025D16Rik C T 8: 105,248,769 P330L probably benign Het
Dock5 A T 14: 67,770,197 probably null Het
Flrt1 G A 19: 7,096,637 L182F probably damaging Het
Foxf1 T C 8: 121,085,162 V255A probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
Gzf1 C T 2: 148,684,766 R386C probably damaging Het
H2-Aa T A 17: 34,287,721 T16S possibly damaging Het
Hdgfrp2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mrgprb2 A T 7: 48,552,019 S319R probably benign Het
Mtrr C T 13: 68,572,613 V288I probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nelfa A T 5: 33,921,907 N107K possibly damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prdm10 G A 9: 31,346,967 A514T probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Ptp4a3 T G 15: 73,756,846 Y152D probably damaging Het
Raph1 A G 1: 60,499,620 C389R unknown Het
Rcc1 T C 4: 132,335,785 E170G probably benign Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tex40 A G 19: 6,922,652 S162P possibly damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in Vmn1r174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Vmn1r174 APN 7 23754533 missense possibly damaging 0.77
IGL00950:Vmn1r174 APN 7 23754486 missense possibly damaging 0.96
IGL01484:Vmn1r174 APN 7 23754324 nonsense probably null
IGL02014:Vmn1r174 APN 7 23754158 missense probably damaging 1.00
IGL02190:Vmn1r174 APN 7 23754827 missense unknown
IGL03265:Vmn1r174 APN 7 23754473 nonsense probably null
IGL03335:Vmn1r174 APN 7 23754512 missense probably benign 0.41
R0529:Vmn1r174 UTSW 7 23754197 missense probably benign 0.00
R1489:Vmn1r174 UTSW 7 23754556 nonsense probably null
R1645:Vmn1r174 UTSW 7 23754352 missense possibly damaging 0.87
R1691:Vmn1r174 UTSW 7 23753912 start codon destroyed probably null 1.00
R1753:Vmn1r174 UTSW 7 23754197 missense probably benign 0.00
R1939:Vmn1r174 UTSW 7 23754107 missense probably damaging 0.99
R1988:Vmn1r174 UTSW 7 23754625 missense probably damaging 0.98
R2299:Vmn1r174 UTSW 7 23754004 missense probably benign 0.08
R4429:Vmn1r174 UTSW 7 23754140 missense probably benign 0.02
R4516:Vmn1r174 UTSW 7 23754343 missense probably benign 0.01
R4589:Vmn1r174 UTSW 7 23754779 nonsense probably null
R5175:Vmn1r174 UTSW 7 23754728 missense probably benign 0.03
R5392:Vmn1r174 UTSW 7 23754802 missense unknown
R5503:Vmn1r174 UTSW 7 23754137 missense probably benign 0.03
R5568:Vmn1r174 UTSW 7 23754494 missense probably damaging 0.96
R6705:Vmn1r174 UTSW 7 23754426 missense probably benign 0.25
R8190:Vmn1r174 UTSW 7 23754143 missense probably damaging 1.00
X0011:Vmn1r174 UTSW 7 23754481 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCCACGATGCCATATTCATCAG -3'
(R):5'- CAGATGTTCTACCCAGGTTTATTGAG -3'

Sequencing Primer
(F):5'- CGATGCCATATTCATCAGCATCATGG -3'
(R):5'- CCCAGGTTTATTGAGTATCAGTGAC -3'
Posted On2020-07-13