Mutagenetix > Incidental Mutations

Incidental Mutation 'R8168:Arhgef1'

633904

Institutional Source

Beutler Lab

Gene Symbol

Arhgef1

Ensembl Gene

ENSMUSG00000040940

Gene Name

Rho guanine nucleotide exchange factor (GEF) 1

Synonyms

Lbcl2, Lsc

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.412) question?

Stock #

R8168 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24902912-24926594 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24925406 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 862 (T862A)

Ref Sequence

ENSEMBL: ENSMUSP00000096280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000205295] [ENSMUST00000206508] [ENSMUST00000206705]

Predicted Effect

probably benign
Transcript: ENSMUST00000047873
AA Change: T803A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940
AA Change: T803A

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	1.3e-72	PFAM
low complexity region	380	400	N/A	INTRINSIC
RhoGEF	419	603	1.87e-63	SMART
PH	647	761	4.68e-5	SMART
low complexity region	845	864	N/A	INTRINSIC
coiled coil region	867	890	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098683
AA Change: T862A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940
AA Change: T862A

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	2.2e-78	PFAM
PDB:3ODW\|B	238	384	2e-57	PDB
low complexity region	396	412	N/A	INTRINSIC
low complexity region	439	459	N/A	INTRINSIC
RhoGEF	478	662	1.87e-63	SMART
PH	706	820	4.68e-5	SMART
low complexity region	904	923	N/A	INTRINSIC
coiled coil region	926	949	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117419
AA Change: T803A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940
AA Change: T803A

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	1.3e-72	PFAM
low complexity region	380	400	N/A	INTRINSIC
RhoGEF	419	603	1.87e-63	SMART
PH	647	761	4.68e-5	SMART
low complexity region	845	864	N/A	INTRINSIC
coiled coil region	867	890	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117796
AA Change: T859A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940
AA Change: T859A

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	7.3e-73	PFAM
low complexity region	393	409	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
RhoGEF	475	659	1.87e-63	SMART
PH	703	817	4.68e-5	SMART
low complexity region	901	920	N/A	INTRINSIC
coiled coil region	923	946	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132751
AA Change: T563A

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940
AA Change: T563A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	70	89	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
low complexity region	140	160	N/A	INTRINSIC
RhoGEF	179	363	1.87e-63	SMART
PH	407	521	4.68e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000205295

Predicted Effect

probably benign
Transcript: ENSMUST00000206508
AA Change: T802A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000206705

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	G	A	10: 77,982,944	A150T	probably benign	Het
9430020K01Rik	A	T	18: 4,675,094	D952V	probably benign	Het
AI607873	A	C	1: 173,729,938	S411R	probably benign	Het
Ano4	A	G	10: 88,980,995	I652T	probably damaging	Het
Atp6v1b2	T	C	8: 69,108,331	S404P	possibly damaging	Het
Cfap54	A	T	10: 92,908,877	S2170T	unknown	Het
Copa	A	T	1: 172,099,672	H204L	probably damaging	Het
Cwc22	A	C	2: 77,927,271	V171G	probably damaging	Het
D230025D16Rik	C	T	8: 105,248,769	P330L	probably benign	Het
Dock5	A	T	14: 67,770,197		probably null	Het
Flrt1	G	A	19: 7,096,637	L182F	probably damaging	Het
Foxf1	T	C	8: 121,085,162	V255A	probably damaging	Het
Gnptab	G	T	10: 88,419,133	A194S	probably benign	Het
Gzf1	C	T	2: 148,684,766	R386C	probably damaging	Het
H2-Aa	T	A	17: 34,287,721	T16S	possibly damaging	Het
Hdgfrp2	T	C	17: 56,082,282	F52S	probably damaging	Het
Htt	A	G	5: 34,882,956	N2154S	probably benign	Het
Lama3	T	A	18: 12,506,942	W65R	probably null	Het
Mef2c	G	T	13: 83,656,350	L356F	probably damaging	Het
Mrgprb2	A	T	7: 48,552,019	S319R	probably benign	Het
Mtrr	C	T	13: 68,572,613	V288I	probably benign	Het
Myo18a	T	A	11: 77,821,142	I713N	probably damaging	Het
Nelfa	A	T	5: 33,921,907	N107K	possibly damaging	Het
Nim1k	A	T	13: 119,712,752	V202D	probably damaging	Het
Nlrc4	T	C	17: 74,445,211	T726A	probably benign	Het
Olfr1154	T	A	2: 87,903,199	H159L	probably damaging	Het
Olfr1208	T	A	2: 88,896,776	M274L	probably benign	Het
Prdm10	G	A	9: 31,346,967	A514T	probably benign	Het
Prg4	T	A	1: 150,455,850	E357D	unknown	Het
Ptp4a3	T	G	15: 73,756,846	Y152D	probably damaging	Het
Raph1	A	G	1: 60,499,620	C389R	unknown	Het
Rcc1	T	C	4: 132,335,785	E170G	probably benign	Het
Spag17	C	T	3: 100,034,984	T775M	possibly damaging	Het
Srcap	T	A	7: 127,542,523	V1825D	probably damaging	Het
Tex40	A	G	19: 6,922,652	S162P	possibly damaging	Het
Tshr	T	A	12: 91,511,965	H195Q	probably benign	Het
Vmn1r174	A	T	7: 23,754,671	D254V	probably damaging	Het
Vps13a	A	C	19: 16,749,548	I244M	probably benign	Het

Other mutations in Arhgef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Arhgef1	APN	7	24908359	missense	possibly damaging	0.93
IGL00901:Arhgef1	APN	7	24912693	missense	probably damaging	1.00
IGL01139:Arhgef1	APN	7	24925951	unclassified	probably benign
IGL01479:Arhgef1	APN	7	24912603	missense	probably benign	0.01
IGL01935:Arhgef1	APN	7	24921882	missense	probably damaging	1.00
IGL01944:Arhgef1	APN	7	24925783	critical splice acceptor site	probably null
IGL02032:Arhgef1	APN	7	24923371	missense	probably benign	0.23
IGL02059:Arhgef1	APN	7	24912552	splice site	probably benign
IGL02202:Arhgef1	APN	7	24913429	nonsense	probably null
IGL02324:Arhgef1	APN	7	24923815	missense	probably damaging	1.00
IGL02328:Arhgef1	APN	7	24923815	missense	probably damaging	1.00
IGL03027:Arhgef1	APN	7	24923732	missense	probably damaging	0.98
IGL03227:Arhgef1	APN	7	24922851	missense	probably damaging	1.00
IGL03404:Arhgef1	APN	7	24916843	missense	probably benign	0.07
BB009:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
BB019:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
R0082:Arhgef1	UTSW	7	24912605	nonsense	probably null
R0277:Arhgef1	UTSW	7	24923799	unclassified	probably benign
R0336:Arhgef1	UTSW	7	24921957	missense	possibly damaging	0.77
R0494:Arhgef1	UTSW	7	24919360	intron	probably benign
R0668:Arhgef1	UTSW	7	24907920	missense	possibly damaging	0.63
R1520:Arhgef1	UTSW	7	24919704	missense	probably damaging	1.00
R1531:Arhgef1	UTSW	7	24924998	missense	probably damaging	0.99
R1656:Arhgef1	UTSW	7	24913632	missense	probably damaging	1.00
R2979:Arhgef1	UTSW	7	24907751	missense	unknown
R3855:Arhgef1	UTSW	7	24919272	missense	probably damaging	1.00
R3856:Arhgef1	UTSW	7	24919272	missense	probably damaging	1.00
R4080:Arhgef1	UTSW	7	24925846	missense	probably damaging	0.96
R4081:Arhgef1	UTSW	7	24925846	missense	probably damaging	0.96
R4583:Arhgef1	UTSW	7	24912571	missense	probably benign	0.09
R4750:Arhgef1	UTSW	7	24918576	intron	probably benign
R4914:Arhgef1	UTSW	7	24923839	missense	probably damaging	1.00
R5255:Arhgef1	UTSW	7	24925022	missense	probably damaging	1.00
R5275:Arhgef1	UTSW	7	24919352	critical splice donor site	probably null
R5295:Arhgef1	UTSW	7	24919352	critical splice donor site	probably null
R5430:Arhgef1	UTSW	7	24912307	splice site	probably null
R5604:Arhgef1	UTSW	7	24912785	missense	probably benign	0.09
R6150:Arhgef1	UTSW	7	24919357	splice site	probably null
R6151:Arhgef1	UTSW	7	24917942	missense	probably benign	0.00
R6788:Arhgef1	UTSW	7	24919780	splice site	probably null
R6943:Arhgef1	UTSW	7	24923731	missense	probably benign	0.01
R6988:Arhgef1	UTSW	7	24916923	missense	probably benign	0.04
R7422:Arhgef1	UTSW	7	24916036	missense	probably benign	0.00
R7701:Arhgef1	UTSW	7	24912578	missense	probably benign	0.01
R7706:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7707:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7708:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7932:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
R7967:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7970:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7995:Arhgef1	UTSW	7	24919216	missense	probably damaging	0.99
R8029:Arhgef1	UTSW	7	24919738	missense	probably damaging	1.00
R8132:Arhgef1	UTSW	7	24907662	intron	probably benign
R8132:Arhgef1	UTSW	7	24919749	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTACCTGTACCCCAATGTG -3'
(R):5'- TACAGACATCTGAAAGACGGAC -3'

Sequencing Primer
(F):5'- CGTCTTTGGGCCAGGGATAC -3'
(R):5'- GGACGGAGCCTTTCACTAGTTC -3'

Posted On

2020-07-13