Incidental Mutation 'R8168:Mrgprb2'
ID633905
Institutional Source Beutler Lab
Gene Symbol Mrgprb2
Ensembl Gene ENSMUSG00000050425
Gene NameMAS-related GPR, member B2
Synonyms4833406I20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8168 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location48550965-48558086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48552019 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 319 (S319R)
Ref Sequence ENSEMBL: ENSMUSP00000061878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052730]
Predicted Effect probably benign
Transcript: ENSMUST00000052730
AA Change: S319R

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061878
Gene: ENSMUSG00000050425
AA Change: S319R

DomainStartEndE-ValueType
Pfam:7tm_1 54 286 2.1e-7 PFAM
low complexity region 293 308 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired mast cell activation and inflammatory response after 48/80 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
9430020K01Rik A T 18: 4,675,094 D952V probably benign Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Atp6v1b2 T C 8: 69,108,331 S404P possibly damaging Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
D230025D16Rik C T 8: 105,248,769 P330L probably benign Het
Dock5 A T 14: 67,770,197 probably null Het
Flrt1 G A 19: 7,096,637 L182F probably damaging Het
Foxf1 T C 8: 121,085,162 V255A probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
Gzf1 C T 2: 148,684,766 R386C probably damaging Het
H2-Aa T A 17: 34,287,721 T16S possibly damaging Het
Hdgfrp2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mtrr C T 13: 68,572,613 V288I probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nelfa A T 5: 33,921,907 N107K possibly damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prdm10 G A 9: 31,346,967 A514T probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Ptp4a3 T G 15: 73,756,846 Y152D probably damaging Het
Raph1 A G 1: 60,499,620 C389R unknown Het
Rcc1 T C 4: 132,335,785 E170G probably benign Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tex40 A G 19: 6,922,652 S162P possibly damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vmn1r174 A T 7: 23,754,671 D254V probably damaging Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in Mrgprb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Mrgprb2 APN 7 48551998 missense probably benign 0.29
IGL01509:Mrgprb2 APN 7 48552926 missense possibly damaging 0.70
IGL01978:Mrgprb2 APN 7 48552564 missense probably damaging 0.98
IGL02307:Mrgprb2 APN 7 48552896 missense probably benign 0.01
IGL02726:Mrgprb2 APN 7 48552870 missense probably damaging 0.97
IGL03393:Mrgprb2 APN 7 48552902 missense probably benign 0.13
R0190:Mrgprb2 UTSW 7 48552777 missense possibly damaging 0.95
R0334:Mrgprb2 UTSW 7 48552329 missense probably damaging 1.00
R0514:Mrgprb2 UTSW 7 48551970 missense probably benign 0.05
R2177:Mrgprb2 UTSW 7 48552380 missense probably benign 0.11
R2932:Mrgprb2 UTSW 7 48552446 missense probably benign 0.17
R3417:Mrgprb2 UTSW 7 48552533 missense probably damaging 0.98
R3953:Mrgprb2 UTSW 7 48552368 missense possibly damaging 0.78
R5673:Mrgprb2 UTSW 7 48552373 missense probably benign 0.00
R5733:Mrgprb2 UTSW 7 48552513 missense probably benign 0.01
R5890:Mrgprb2 UTSW 7 48551959 makesense probably null
R5915:Mrgprb2 UTSW 7 48552806 missense probably benign 0.14
R6147:Mrgprb2 UTSW 7 48552365 missense possibly damaging 0.64
R6381:Mrgprb2 UTSW 7 48552390 missense probably benign 0.01
R6414:Mrgprb2 UTSW 7 48552381 missense probably benign 0.01
R6965:Mrgprb2 UTSW 7 48552849 missense probably damaging 0.97
R7017:Mrgprb2 UTSW 7 48552837 missense probably benign 0.08
R7341:Mrgprb2 UTSW 7 48552896 missense probably benign 0.01
R7399:Mrgprb2 UTSW 7 48552142 missense probably damaging 1.00
R8189:Mrgprb2 UTSW 7 48552754 nonsense probably null
Z1177:Mrgprb2 UTSW 7 48552973 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TATGACAAGACCCATTTCTCTCAAC -3'
(R):5'- AGCGAATTCCTATGACCAGGC -3'

Sequencing Primer
(F):5'- AAGACCCATTTCTCTCAACTTTTAC -3'
(R):5'- CGAATTCCTATGACCAGGCTGTATG -3'
Posted On2020-07-13