Incidental Mutation 'R8168:Atp6v1b2'
ID633907
Institutional Source Beutler Lab
Gene Symbol Atp6v1b2
Ensembl Gene ENSMUSG00000006273
Gene NameATPase, H+ transporting, lysosomal V1 subunit B2
SynonymsAtp6b2, HO57
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8168 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location69088646-69113711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69108331 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 404 (S404P)
Ref Sequence ENSEMBL: ENSMUSP00000006435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006435]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006435
AA Change: S404P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006435
Gene: ENSMUSG00000006273
AA Change: S404P

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 50 116 3.2e-14 PFAM
Pfam:ATP-synt_ab 173 399 1.9e-69 PFAM
Pfam:ATP-synt_ab_C 416 510 5.1e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. The protein encoded by this gene is one of two V1 domain B subunit isoforms and is the only B isoform highly expressed in osteoclasts. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
9430020K01Rik A T 18: 4,675,094 D952V probably benign Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
D230025D16Rik C T 8: 105,248,769 P330L probably benign Het
Dock5 A T 14: 67,770,197 probably null Het
Flrt1 G A 19: 7,096,637 L182F probably damaging Het
Foxf1 T C 8: 121,085,162 V255A probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
Gzf1 C T 2: 148,684,766 R386C probably damaging Het
H2-Aa T A 17: 34,287,721 T16S possibly damaging Het
Hdgfrp2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mrgprb2 A T 7: 48,552,019 S319R probably benign Het
Mtrr C T 13: 68,572,613 V288I probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nelfa A T 5: 33,921,907 N107K possibly damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prdm10 G A 9: 31,346,967 A514T probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Ptp4a3 T G 15: 73,756,846 Y152D probably damaging Het
Raph1 A G 1: 60,499,620 C389R unknown Het
Rcc1 T C 4: 132,335,785 E170G probably benign Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tex40 A G 19: 6,922,652 S162P possibly damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vmn1r174 A T 7: 23,754,671 D254V probably damaging Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in Atp6v1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Atp6v1b2 APN 8 69088934 splice site probably null
IGL00908:Atp6v1b2 APN 8 69096266 missense probably benign 0.00
IGL01914:Atp6v1b2 APN 8 69096280 splice site probably benign
IGL03010:Atp6v1b2 APN 8 69105882 missense probably damaging 0.97
IGL03376:Atp6v1b2 APN 8 69102159 splice site probably benign
R0127:Atp6v1b2 UTSW 8 69103460 missense probably damaging 1.00
R0427:Atp6v1b2 UTSW 8 69101432 missense probably damaging 1.00
R0523:Atp6v1b2 UTSW 8 69109985 missense possibly damaging 0.52
R1754:Atp6v1b2 UTSW 8 69101961 missense probably benign 0.25
R1932:Atp6v1b2 UTSW 8 69102807 nonsense probably null
R1954:Atp6v1b2 UTSW 8 69105903 missense possibly damaging 0.95
R2228:Atp6v1b2 UTSW 8 69102759 splice site probably null
R2229:Atp6v1b2 UTSW 8 69102759 splice site probably null
R4448:Atp6v1b2 UTSW 8 69102022 missense probably benign
R4738:Atp6v1b2 UTSW 8 69103410 missense probably benign
R5243:Atp6v1b2 UTSW 8 69103739 missense probably benign 0.07
R5388:Atp6v1b2 UTSW 8 69101437 missense probably benign 0.00
R5664:Atp6v1b2 UTSW 8 69107620 missense probably damaging 0.99
R5774:Atp6v1b2 UTSW 8 69101961 missense probably damaging 0.97
R5894:Atp6v1b2 UTSW 8 69107566 splice site probably null
R6015:Atp6v1b2 UTSW 8 69102496 missense probably damaging 1.00
R6147:Atp6v1b2 UTSW 8 69102482 nonsense probably null
R6217:Atp6v1b2 UTSW 8 69109878 critical splice acceptor site probably null
R6636:Atp6v1b2 UTSW 8 69101374 missense probably damaging 1.00
R6637:Atp6v1b2 UTSW 8 69101374 missense probably damaging 1.00
R7032:Atp6v1b2 UTSW 8 69088896 missense probably benign 0.44
R7108:Atp6v1b2 UTSW 8 69102501 missense probably damaging 1.00
R7184:Atp6v1b2 UTSW 8 69102567 missense possibly damaging 0.55
R7578:Atp6v1b2 UTSW 8 69103476 missense probably benign 0.01
R8342:Atp6v1b2 UTSW 8 69101383 missense probably benign 0.00
R8380:Atp6v1b2 UTSW 8 69103390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTAGAAGATAAGGTCCCAGGC -3'
(R):5'- GGCTGCTTTGTTCCAGAGAG -3'

Sequencing Primer
(F):5'- GCCTCACCTAGGGAAACAGTG -3'
(R):5'- TGTTCCAGAGAGTTATTCCAACC -3'
Posted On2020-07-13