Incidental Mutation 'R8168:D230025D16Rik'
ID633908
Institutional Source Beutler Lab
Gene Symbol D230025D16Rik
Ensembl Gene ENSMUSG00000031889
Gene NameRIKEN cDNA D230025D16 gene
SynonymsLin10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R8168 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105225145-105253053 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105248769 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 330 (P330L)
Ref Sequence ENSEMBL: ENSMUSP00000034361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034361] [ENSMUST00000093217] [ENSMUST00000124113] [ENSMUST00000136822] [ENSMUST00000141957]
Predicted Effect probably benign
Transcript: ENSMUST00000034361
AA Change: P330L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000034361
Gene: ENSMUSG00000031889
AA Change: P330L

DomainStartEndE-ValueType
Pfam:UPF0183 15 407 1.7e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093217
SMART Domains Protein: ENSMUSP00000133023
Gene: ENSMUSG00000069920

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
Pfam:Galactosyl_T 132 331 1e-40 PFAM
Pfam:Fringe 212 335 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124113
SMART Domains Protein: ENSMUSP00000119743
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 120 1.9e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136822
SMART Domains Protein: ENSMUSP00000130840
Gene: ENSMUSG00000069920

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
Pfam:Galactosyl_T 132 331 1e-40 PFAM
Pfam:Fringe 212 335 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141957
SMART Domains Protein: ENSMUSP00000119148
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 161 2.8e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
9430020K01Rik A T 18: 4,675,094 D952V probably benign Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Atp6v1b2 T C 8: 69,108,331 S404P possibly damaging Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
Dock5 A T 14: 67,770,197 probably null Het
Flrt1 G A 19: 7,096,637 L182F probably damaging Het
Foxf1 T C 8: 121,085,162 V255A probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
Gzf1 C T 2: 148,684,766 R386C probably damaging Het
H2-Aa T A 17: 34,287,721 T16S possibly damaging Het
Hdgfrp2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mrgprb2 A T 7: 48,552,019 S319R probably benign Het
Mtrr C T 13: 68,572,613 V288I probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nelfa A T 5: 33,921,907 N107K possibly damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prdm10 G A 9: 31,346,967 A514T probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Ptp4a3 T G 15: 73,756,846 Y152D probably damaging Het
Raph1 A G 1: 60,499,620 C389R unknown Het
Rcc1 T C 4: 132,335,785 E170G probably benign Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tex40 A G 19: 6,922,652 S162P possibly damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vmn1r174 A T 7: 23,754,671 D254V probably damaging Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in D230025D16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:D230025D16Rik APN 8 105240001 missense probably damaging 0.99
IGL02058:D230025D16Rik APN 8 105239709 missense probably damaging 1.00
IGL02162:D230025D16Rik APN 8 105239973 splice site probably benign
IGL02264:D230025D16Rik APN 8 105234546 missense possibly damaging 0.67
IGL02512:D230025D16Rik APN 8 105234478 splice site probably benign
FR4340:D230025D16Rik UTSW 8 105241098 missense probably benign
FR4342:D230025D16Rik UTSW 8 105241098 missense probably benign
FR4589:D230025D16Rik UTSW 8 105241098 missense probably benign
R0564:D230025D16Rik UTSW 8 105239971 splice site probably benign
R1458:D230025D16Rik UTSW 8 105246556 critical splice donor site probably null
R1705:D230025D16Rik UTSW 8 105238472 splice site probably benign
R1860:D230025D16Rik UTSW 8 105240071 missense probably null 1.00
R1861:D230025D16Rik UTSW 8 105240071 missense probably null 1.00
R1893:D230025D16Rik UTSW 8 105246501 missense probably damaging 1.00
R1969:D230025D16Rik UTSW 8 105246500 missense possibly damaging 0.81
R2246:D230025D16Rik UTSW 8 105246500 missense possibly damaging 0.81
R3914:D230025D16Rik UTSW 8 105239983 missense probably benign 0.00
R4175:D230025D16Rik UTSW 8 105241131 missense probably benign 0.09
R4176:D230025D16Rik UTSW 8 105241131 missense probably benign 0.09
R4602:D230025D16Rik UTSW 8 105246888 missense possibly damaging 0.72
R5965:D230025D16Rik UTSW 8 105234539 missense probably damaging 1.00
R7717:D230025D16Rik UTSW 8 105251604 missense probably benign 0.12
R7787:D230025D16Rik UTSW 8 105231188 missense probably damaging 1.00
R7881:D230025D16Rik UTSW 8 105249452 missense probably benign 0.21
Z1088:D230025D16Rik UTSW 8 105231172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCCAGTGAATGTTGTGAAAG -3'
(R):5'- CACTACACTTGGCTGGCTTC -3'

Sequencing Primer
(F):5'- CCCAGTGAATGTTGTGAAAGATCCC -3'
(R):5'- GGGCATCAGCTCTCATTACAGATG -3'
Posted On2020-07-13