Mutagenetix > Incidental Mutations

Incidental Mutation 'R8168:Foxf1'

633909

Institutional Source

Beutler Lab

Gene Symbol

Foxf1

Ensembl Gene

ENSMUSG00000042812

Gene Name

forkhead box F1

Synonyms

FREAC1, Hfh8, Freac-1, Foxf1a, Foxf1, HFH-8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8168 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121084386-121088144 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121085162 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 255 (V255A)

Ref Sequence

ENSEMBL: ENSMUSP00000137662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127664] [ENSMUST00000181504]

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000181504
AA Change: V255A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000137662
Gene: ENSMUSG00000042812
AA Change: V255A

Domain	Start	End	E-Value	Type
low complexity region	12	42	N/A	INTRINSIC
FH	46	136	6.02e-59	SMART
low complexity region	137	146	N/A	INTRINSIC
low complexity region	217	230	N/A	INTRINSIC
low complexity region	263	276	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in the regulation of pulmonary genes as well as embryonic development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in mid-gestation lethality, defects in extraembryonic and lateral plate mesoderm differentiation, failure of embryo turning, absence of yolk sac and allantois vasculogenesis, retarded somite and posterior embryo development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	G	A	10: 77,982,944	A150T	probably benign	Het
9430020K01Rik	A	T	18: 4,675,094	D952V	probably benign	Het
AI607873	A	C	1: 173,729,938	S411R	probably benign	Het
Ano4	A	G	10: 88,980,995	I652T	probably damaging	Het
Arhgef1	A	G	7: 24,925,406	T862A	probably benign	Het
Atp6v1b2	T	C	8: 69,108,331	S404P	possibly damaging	Het
Cfap54	A	T	10: 92,908,877	S2170T	unknown	Het
Copa	A	T	1: 172,099,672	H204L	probably damaging	Het
Cwc22	A	C	2: 77,927,271	V171G	probably damaging	Het
D230025D16Rik	C	T	8: 105,248,769	P330L	probably benign	Het
Dock5	A	T	14: 67,770,197		probably null	Het
Flrt1	G	A	19: 7,096,637	L182F	probably damaging	Het
Gnptab	G	T	10: 88,419,133	A194S	probably benign	Het
Gzf1	C	T	2: 148,684,766	R386C	probably damaging	Het
H2-Aa	T	A	17: 34,287,721	T16S	possibly damaging	Het
Hdgfrp2	T	C	17: 56,082,282	F52S	probably damaging	Het
Htt	A	G	5: 34,882,956	N2154S	probably benign	Het
Lama3	T	A	18: 12,506,942	W65R	probably null	Het
Mef2c	G	T	13: 83,656,350	L356F	probably damaging	Het
Mrgprb2	A	T	7: 48,552,019	S319R	probably benign	Het
Mtrr	C	T	13: 68,572,613	V288I	probably benign	Het
Myo18a	T	A	11: 77,821,142	I713N	probably damaging	Het
Nelfa	A	T	5: 33,921,907	N107K	possibly damaging	Het
Nim1k	A	T	13: 119,712,752	V202D	probably damaging	Het
Nlrc4	T	C	17: 74,445,211	T726A	probably benign	Het
Olfr1154	T	A	2: 87,903,199	H159L	probably damaging	Het
Olfr1208	T	A	2: 88,896,776	M274L	probably benign	Het
Prdm10	G	A	9: 31,346,967	A514T	probably benign	Het
Prg4	T	A	1: 150,455,850	E357D	unknown	Het
Ptp4a3	T	G	15: 73,756,846	Y152D	probably damaging	Het
Raph1	A	G	1: 60,499,620	C389R	unknown	Het
Rcc1	T	C	4: 132,335,785	E170G	probably benign	Het
Spag17	C	T	3: 100,034,984	T775M	possibly damaging	Het
Srcap	T	A	7: 127,542,523	V1825D	probably damaging	Het
Tex40	A	G	19: 6,922,652	S162P	possibly damaging	Het
Tshr	T	A	12: 91,511,965	H195Q	probably benign	Het
Vmn1r174	A	T	7: 23,754,671	D254V	probably damaging	Het
Vps13a	A	C	19: 16,749,548	I244M	probably benign	Het

Other mutations in Foxf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02040:Foxf1	APN	8	121085345	missense	probably damaging	0.99
IGL02113:Foxf1	APN	8	121084565	missense	probably damaging	1.00
IGL03167:Foxf1	APN	8	121084908	nonsense	probably null
R0359:Foxf1	UTSW	8	121085003	missense	possibly damaging	0.69
R0621:Foxf1	UTSW	8	121085180	missense	probably damaging	0.98
R1523:Foxf1	UTSW	8	121084558	splice site	probably null
R4854:Foxf1	UTSW	8	121086814	missense	probably benign
R5435:Foxf1	UTSW	8	121084492	missense	probably damaging	0.99
R6423:Foxf1	UTSW	8	121085095	missense	possibly damaging	0.90
R7582:Foxf1	UTSW	8	121084691	missense	possibly damaging	0.94
R7853:Foxf1	UTSW	8	121084699	missense	probably damaging	0.99
R8095:Foxf1	UTSW	8	121086812	missense	probably benign	0.01
Z1176:Foxf1	UTSW	8	121084529	missense	probably damaging	0.99
Z1177:Foxf1	UTSW	8	121084435	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTGGCTGGCAACGTGGAC -3'
(R):5'- CAAGATCGGTTCACAGTGGC -3'

Sequencing Primer
(F):5'- GCAACGTGGACGGCATG -3'
(R):5'- TCACAGTGGCTGTCATGGC -3'

Posted On

2020-07-13