Incidental Mutation 'R8168:Foxf1'
ID 633909
Institutional Source Beutler Lab
Gene Symbol Foxf1
Ensembl Gene ENSMUSG00000042812
Gene Name forkhead box F1
Synonyms FREAC1, Hfh8, Freac-1, Foxf1a, Foxf1, HFH-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8168 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 121084386-121088144 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121085162 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 255 (V255A)
Ref Sequence ENSEMBL: ENSMUSP00000137662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127664] [ENSMUST00000181504]
AlphaFold Q61080
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181504
AA Change: V255A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137662
Gene: ENSMUSG00000042812
AA Change: V255A

DomainStartEndE-ValueType
low complexity region 12 42 N/A INTRINSIC
FH 46 136 6.02e-59 SMART
low complexity region 137 146 N/A INTRINSIC
low complexity region 217 230 N/A INTRINSIC
low complexity region 263 276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in the regulation of pulmonary genes as well as embryonic development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in mid-gestation lethality, defects in extraembryonic and lateral plate mesoderm differentiation, failure of embryo turning, absence of yolk sac and allantois vasculogenesis, retarded somite and posterior embryo development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
9430020K01Rik A T 18: 4,675,094 D952V probably benign Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Atp6v1b2 T C 8: 69,108,331 S404P possibly damaging Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
D230025D16Rik C T 8: 105,248,769 P330L probably benign Het
Dock5 A T 14: 67,770,197 probably null Het
Flrt1 G A 19: 7,096,637 L182F probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
Gzf1 C T 2: 148,684,766 R386C probably damaging Het
H2-Aa T A 17: 34,287,721 T16S possibly damaging Het
Hdgfrp2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mrgprb2 A T 7: 48,552,019 S319R probably benign Het
Mtrr C T 13: 68,572,613 V288I probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nelfa A T 5: 33,921,907 N107K possibly damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prdm10 G A 9: 31,346,967 A514T probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Ptp4a3 T G 15: 73,756,846 Y152D probably damaging Het
Raph1 A G 1: 60,499,620 C389R unknown Het
Rcc1 T C 4: 132,335,785 E170G probably benign Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tex40 A G 19: 6,922,652 S162P possibly damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vmn1r174 A T 7: 23,754,671 D254V probably damaging Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in Foxf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Foxf1 APN 8 121085345 missense probably damaging 0.99
IGL02113:Foxf1 APN 8 121084565 missense probably damaging 1.00
IGL03167:Foxf1 APN 8 121084908 nonsense probably null
R0359:Foxf1 UTSW 8 121085003 missense possibly damaging 0.69
R0621:Foxf1 UTSW 8 121085180 missense probably damaging 0.98
R1523:Foxf1 UTSW 8 121084558 splice site probably null
R4854:Foxf1 UTSW 8 121086814 missense probably benign
R5435:Foxf1 UTSW 8 121084492 missense probably damaging 0.99
R6423:Foxf1 UTSW 8 121085095 missense possibly damaging 0.90
R7582:Foxf1 UTSW 8 121084691 missense possibly damaging 0.94
R7853:Foxf1 UTSW 8 121084699 missense probably damaging 0.99
R8095:Foxf1 UTSW 8 121086812 missense probably benign 0.01
R8841:Foxf1 UTSW 8 121085180 missense probably damaging 0.98
R9232:Foxf1 UTSW 8 121084976 missense possibly damaging 0.95
Z1176:Foxf1 UTSW 8 121084529 missense probably damaging 0.99
Z1177:Foxf1 UTSW 8 121084435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGGCTGGCAACGTGGAC -3'
(R):5'- CAAGATCGGTTCACAGTGGC -3'

Sequencing Primer
(F):5'- GCAACGTGGACGGCATG -3'
(R):5'- TCACAGTGGCTGTCATGGC -3'
Posted On 2020-07-13