Mutagenetix > Incidental Mutations

Incidental Mutation 'R8168:Tshr'

633916

Institutional Source

Beutler Lab

Gene Symbol

Tshr

Ensembl Gene

ENSMUSG00000020963

Gene Name

thyroid stimulating hormone receptor

Synonyms

pet, hyt, hypothroid

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.349) question?

Stock #

R8168 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91384563-91549808 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 91511965 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 195 (H195Q)

Ref Sequence

ENSEMBL: ENSMUSP00000021346 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021343] [ENSMUST00000021346]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021343
AA Change: H195Q

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021343
Gene: ENSMUSG00000020963
AA Change: H195Q

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:LRR_5	53	143	1e-6	PFAM
Pfam:LRR_5	137	228	3.8e-5	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000021346
AA Change: H195Q

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000021346
Gene: ENSMUSG00000020963
AA Change: H195Q

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:LRR_5	53	153	9.5e-7	PFAM
Pfam:LRR_5	148	244	5.1e-5	PFAM
Pfam:7tm_1	431	678	2.6e-30	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene exhibit profound hypothyroidism, developmental and growth retardation, impaired hearing with cochlear defects, and infertility. One mutation results in high postweaning mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	G	A	10: 77,982,944	A150T	probably benign	Het
9430020K01Rik	A	T	18: 4,675,094	D952V	probably benign	Het
AI607873	A	C	1: 173,729,938	S411R	probably benign	Het
Ano4	A	G	10: 88,980,995	I652T	probably damaging	Het
Arhgef1	A	G	7: 24,925,406	T862A	probably benign	Het
Atp6v1b2	T	C	8: 69,108,331	S404P	possibly damaging	Het
Cfap54	A	T	10: 92,908,877	S2170T	unknown	Het
Copa	A	T	1: 172,099,672	H204L	probably damaging	Het
Cwc22	A	C	2: 77,927,271	V171G	probably damaging	Het
D230025D16Rik	C	T	8: 105,248,769	P330L	probably benign	Het
Dock5	A	T	14: 67,770,197		probably null	Het
Flrt1	G	A	19: 7,096,637	L182F	probably damaging	Het
Foxf1	T	C	8: 121,085,162	V255A	probably damaging	Het
Gnptab	G	T	10: 88,419,133	A194S	probably benign	Het
Gzf1	C	T	2: 148,684,766	R386C	probably damaging	Het
H2-Aa	T	A	17: 34,287,721	T16S	possibly damaging	Het
Hdgfrp2	T	C	17: 56,082,282	F52S	probably damaging	Het
Htt	A	G	5: 34,882,956	N2154S	probably benign	Het
Lama3	T	A	18: 12,506,942	W65R	probably null	Het
Mef2c	G	T	13: 83,656,350	L356F	probably damaging	Het
Mrgprb2	A	T	7: 48,552,019	S319R	probably benign	Het
Mtrr	C	T	13: 68,572,613	V288I	probably benign	Het
Myo18a	T	A	11: 77,821,142	I713N	probably damaging	Het
Nelfa	A	T	5: 33,921,907	N107K	possibly damaging	Het
Nim1k	A	T	13: 119,712,752	V202D	probably damaging	Het
Nlrc4	T	C	17: 74,445,211	T726A	probably benign	Het
Olfr1154	T	A	2: 87,903,199	H159L	probably damaging	Het
Olfr1208	T	A	2: 88,896,776	M274L	probably benign	Het
Prdm10	G	A	9: 31,346,967	A514T	probably benign	Het
Prg4	T	A	1: 150,455,850	E357D	unknown	Het
Ptp4a3	T	G	15: 73,756,846	Y152D	probably damaging	Het
Raph1	A	G	1: 60,499,620	C389R	unknown	Het
Rcc1	T	C	4: 132,335,785	E170G	probably benign	Het
Spag17	C	T	3: 100,034,984	T775M	possibly damaging	Het
Srcap	T	A	7: 127,542,523	V1825D	probably damaging	Het
Tex40	A	G	19: 6,922,652	S162P	possibly damaging	Het
Vmn1r174	A	T	7: 23,754,671	D254V	probably damaging	Het
Vps13a	A	C	19: 16,749,548	I244M	probably benign	Het

Other mutations in Tshr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00647:Tshr	APN	12	91537500	missense	probably damaging	1.00
IGL01503:Tshr	APN	12	91511934	missense	probably damaging	1.00
IGL01730:Tshr	APN	12	91519303	missense	possibly damaging	0.93
IGL02109:Tshr	APN	12	91537992	missense	probably damaging	1.00
IGL02199:Tshr	APN	12	91538283	missense	probably damaging	1.00
IGL02439:Tshr	APN	12	91537547	missense	probably damaging	0.97
IGL02696:Tshr	APN	12	91493329	missense	possibly damaging	0.72
IGL03170:Tshr	APN	12	91537869	missense	probably damaging	1.00
IGL03208:Tshr	APN	12	91533942	missense	probably damaging	1.00
freckle	UTSW	12	91538226	nonsense	probably null
R0017:Tshr	UTSW	12	91537886	missense	possibly damaging	0.95
R0017:Tshr	UTSW	12	91537886	missense	possibly damaging	0.95
R0067:Tshr	UTSW	12	91505283	missense	probably damaging	1.00
R0419:Tshr	UTSW	12	91537869	missense	probably damaging	1.00
R0658:Tshr	UTSW	12	91538226	nonsense	probably null
R0724:Tshr	UTSW	12	91538286	missense	probably damaging	1.00
R1170:Tshr	UTSW	12	91538097	missense	probably damaging	1.00
R1188:Tshr	UTSW	12	91502168	missense	probably benign	0.00
R1548:Tshr	UTSW	12	91534031	missense	probably damaging	1.00
R1677:Tshr	UTSW	12	91537341	missense	possibly damaging	0.81
R1808:Tshr	UTSW	12	91537316	missense	probably benign	0.00
R1934:Tshr	UTSW	12	91537181	missense	probably damaging	0.99
R3980:Tshr	UTSW	12	91537743	missense	probably damaging	1.00
R4008:Tshr	UTSW	12	91537494	missense	probably benign	0.21
R4828:Tshr	UTSW	12	91537790	missense	probably damaging	1.00
R4903:Tshr	UTSW	12	91401188	missense	probably benign	0.09
R4958:Tshr	UTSW	12	91538187	missense	probably damaging	1.00
R5528:Tshr	UTSW	12	91537193	missense	probably damaging	1.00
R5949:Tshr	UTSW	12	91537218	missense	probably damaging	1.00
R6136:Tshr	UTSW	12	91538234	missense	probably benign	0.34
R6147:Tshr	UTSW	12	91538235	missense	possibly damaging	0.84
R6454:Tshr	UTSW	12	91538549	missense	probably benign	0.33
R6572:Tshr	UTSW	12	91538360	missense	probably benign	0.29
R6884:Tshr	UTSW	12	91538102	missense	probably damaging	1.00
R6986:Tshr	UTSW	12	91533957	missense	probably damaging	0.97
R7403:Tshr	UTSW	12	91497774	missense	probably damaging	1.00
R7691:Tshr	UTSW	12	91497741	missense	probably benign	0.00
R7741:Tshr	UTSW	12	91533969	nonsense	probably null
R7769:Tshr	UTSW	12	91538270	missense	probably damaging	1.00
R7784:Tshr	UTSW	12	91505305	missense	probably benign	0.02
R7934:Tshr	UTSW	12	91511928	missense	possibly damaging	0.88
R8060:Tshr	UTSW	12	91538360	missense	probably benign	0.12
R8552:Tshr	UTSW	12	91537285	missense	probably benign	0.00
Z1176:Tshr	UTSW	12	91538491	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- AGCAACACATATGCCACGGG -3'
(R):5'- GGGGCCGACATTAAGTATCC -3'

Sequencing Primer
(F):5'- ACGGGCGATCTGCTTTAC -3'
(R):5'- ACCAGATGGCCCTTGTCAAG -3'

Posted On

2020-07-13