Mutagenetix > Incidental Mutations

Incidental Mutation 'R8168:Mtrr'

633917

Institutional Source

Beutler Lab

Gene Symbol

Mtrr

Ensembl Gene

ENSMUSG00000034617

Gene Name

5-methyltetrahydrofolate-homocysteine methyltransferase reductase

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_172480; MGI: 1891037

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8168 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68560780-68582149 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 68572613 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 288 (V288I)

Ref Sequence

ENSEMBL: ENSMUSP00000039810 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045827]

Predicted Effect

probably benign
Transcript: ENSMUST00000045827
AA Change: V288I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000039810
Gene: ENSMUSG00000034617
AA Change: V288I

Domain	Start	End	E-Value	Type
Pfam:Flavodoxin_5	5	126	2.7e-9	PFAM
Pfam:Flavodoxin_1	6	142	4.3e-32	PFAM
Pfam:FAD_binding_1	267	490	2.6e-51	PFAM
Pfam:NAD_binding_1	540	660	5.4e-21	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: Methionine is an essential amino acid required for protein synthesis and one-carbon metabolism. Its synthesis is catalyzed by the enzyme methionine synthase. Methionine synthase eventually becomes inactive due to the oxidation of its cob(I)alamin cofactor. The protein encoded by this gene regenerates a functional methionine synthase via reductive methylation. It is a member of the ferredoxin-NADP(+) reductase (FNR) family of electron transferases. Mutations in a similar gene in human have been associated with cblE complementation type homocystinuria-megaloblastic anemia and susceptibility to folate-sensitive neural tube defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are viable and display a male-specific reduction in postnatal weight gain as well as hyperhomocysteinemia, hypomethionemia, increased tissue methyltetrahydrofolate, and AdoMet/AdoHcy ratios that range from high to slightly below normal. [provided by MGI curators]

Allele List at MGI

All alleles(46) : Gene trapped(46)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	G	A	10: 77,982,944	A150T	probably benign	Het
9430020K01Rik	A	T	18: 4,675,094	D952V	probably benign	Het
AI607873	A	C	1: 173,729,938	S411R	probably benign	Het
Ano4	A	G	10: 88,980,995	I652T	probably damaging	Het
Arhgef1	A	G	7: 24,925,406	T862A	probably benign	Het
Atp6v1b2	T	C	8: 69,108,331	S404P	possibly damaging	Het
Cfap54	A	T	10: 92,908,877	S2170T	unknown	Het
Copa	A	T	1: 172,099,672	H204L	probably damaging	Het
Cwc22	A	C	2: 77,927,271	V171G	probably damaging	Het
D230025D16Rik	C	T	8: 105,248,769	P330L	probably benign	Het
Dock5	A	T	14: 67,770,197		probably null	Het
Flrt1	G	A	19: 7,096,637	L182F	probably damaging	Het
Foxf1	T	C	8: 121,085,162	V255A	probably damaging	Het
Gnptab	G	T	10: 88,419,133	A194S	probably benign	Het
Gzf1	C	T	2: 148,684,766	R386C	probably damaging	Het
H2-Aa	T	A	17: 34,287,721	T16S	possibly damaging	Het
Hdgfrp2	T	C	17: 56,082,282	F52S	probably damaging	Het
Htt	A	G	5: 34,882,956	N2154S	probably benign	Het
Lama3	T	A	18: 12,506,942	W65R	probably null	Het
Mef2c	G	T	13: 83,656,350	L356F	probably damaging	Het
Mrgprb2	A	T	7: 48,552,019	S319R	probably benign	Het
Myo18a	T	A	11: 77,821,142	I713N	probably damaging	Het
Nelfa	A	T	5: 33,921,907	N107K	possibly damaging	Het
Nim1k	A	T	13: 119,712,752	V202D	probably damaging	Het
Nlrc4	T	C	17: 74,445,211	T726A	probably benign	Het
Olfr1154	T	A	2: 87,903,199	H159L	probably damaging	Het
Olfr1208	T	A	2: 88,896,776	M274L	probably benign	Het
Prdm10	G	A	9: 31,346,967	A514T	probably benign	Het
Prg4	T	A	1: 150,455,850	E357D	unknown	Het
Ptp4a3	T	G	15: 73,756,846	Y152D	probably damaging	Het
Raph1	A	G	1: 60,499,620	C389R	unknown	Het
Rcc1	T	C	4: 132,335,785	E170G	probably benign	Het
Spag17	C	T	3: 100,034,984	T775M	possibly damaging	Het
Srcap	T	A	7: 127,542,523	V1825D	probably damaging	Het
Tex40	A	G	19: 6,922,652	S162P	possibly damaging	Het
Tshr	T	A	12: 91,511,965	H195Q	probably benign	Het
Vmn1r174	A	T	7: 23,754,671	D254V	probably damaging	Het
Vps13a	A	C	19: 16,749,548	I244M	probably benign	Het

Other mutations in Mtrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01787:Mtrr	APN	13	68571147	missense	probably damaging	1.00
IGL01806:Mtrr	APN	13	68580600	missense	possibly damaging	0.92
IGL01808:Mtrr	APN	13	68566093	missense	probably benign	0.00
IGL01875:Mtrr	APN	13	68572609	missense	probably damaging	1.00
IGL02137:Mtrr	APN	13	68568801	missense	possibly damaging	0.75
IGL02186:Mtrr	APN	13	68564357	missense	probably benign
IGL03114:Mtrr	APN	13	68564322	nonsense	probably null
3-1:Mtrr	UTSW	13	68575016	critical splice donor site	probably null
H8562:Mtrr	UTSW	13	68564377	missense	probably damaging	0.97
N/A:Mtrr	UTSW	13	68575397	splice site	probably benign
R0007:Mtrr	UTSW	13	68575330	missense	probably benign	0.02
R0741:Mtrr	UTSW	13	68579539	splice site	probably null
R2140:Mtrr	UTSW	13	68568940	missense	possibly damaging	0.47
R2513:Mtrr	UTSW	13	68566973	nonsense	probably null
R4604:Mtrr	UTSW	13	68564512	splice site	probably null
R5501:Mtrr	UTSW	13	68579647	missense	probably damaging	1.00
R5658:Mtrr	UTSW	13	68568915	missense	possibly damaging	0.67
R6477:Mtrr	UTSW	13	68570073	missense	probably damaging	1.00
R6694:Mtrr	UTSW	13	68564333	missense	probably benign
R6979:Mtrr	UTSW	13	68570003	critical splice donor site	probably null
R7094:Mtrr	UTSW	13	68579684	missense	possibly damaging	0.83
R7296:Mtrr	UTSW	13	68568860	nonsense	probably null
R7354:Mtrr	UTSW	13	68566207	missense	probably damaging	1.00
R7378:Mtrr	UTSW	13	68564402	missense	probably damaging	1.00
R7546:Mtrr	UTSW	13	68582149	unclassified	probably benign
R7562:Mtrr	UTSW	13	68566217	missense	probably damaging	0.96
R7759:Mtrr	UTSW	13	68570027	missense	probably damaging	1.00
R7975:Mtrr	UTSW	13	68579547	splice site	probably null
R8101:Mtrr	UTSW	13	68577621	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCACTCAAGAGGAACGAG -3'
(R):5'- CTGGATAGTTGTAAGCCTAGGG -3'

Sequencing Primer
(F):5'- CACTCAAGAGGAACGAGGCGAG -3'
(R):5'- GTCTCAGCAACTTCTTAATGTGG -3'

Posted On

2020-07-13