Incidental Mutation 'R8168:Mtrr'
ID633917
Institutional Source Beutler Lab
Gene Symbol Mtrr
Ensembl Gene ENSMUSG00000034617
Gene Name5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_172480; MGI: 1891037

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8168 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location68560780-68582149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68572613 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 288 (V288I)
Ref Sequence ENSEMBL: ENSMUSP00000039810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045827]
Predicted Effect probably benign
Transcript: ENSMUST00000045827
AA Change: V288I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000039810
Gene: ENSMUSG00000034617
AA Change: V288I

DomainStartEndE-ValueType
Pfam:Flavodoxin_5 5 126 2.7e-9 PFAM
Pfam:Flavodoxin_1 6 142 4.3e-32 PFAM
Pfam:FAD_binding_1 267 490 2.6e-51 PFAM
Pfam:NAD_binding_1 540 660 5.4e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Methionine is an essential amino acid required for protein synthesis and one-carbon metabolism. Its synthesis is catalyzed by the enzyme methionine synthase. Methionine synthase eventually becomes inactive due to the oxidation of its cob(I)alamin cofactor. The protein encoded by this gene regenerates a functional methionine synthase via reductive methylation. It is a member of the ferredoxin-NADP(+) reductase (FNR) family of electron transferases. Mutations in a similar gene in human have been associated with cblE complementation type homocystinuria-megaloblastic anemia and susceptibility to folate-sensitive neural tube defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are viable and display a male-specific reduction in postnatal weight gain as well as hyperhomocysteinemia, hypomethionemia, increased tissue methyltetrahydrofolate, and AdoMet/AdoHcy ratios that range from high to slightly below normal. [provided by MGI curators]
Allele List at MGI

All alleles(46) : Gene trapped(46)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
9430020K01Rik A T 18: 4,675,094 D952V probably benign Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Atp6v1b2 T C 8: 69,108,331 S404P possibly damaging Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
D230025D16Rik C T 8: 105,248,769 P330L probably benign Het
Dock5 A T 14: 67,770,197 probably null Het
Flrt1 G A 19: 7,096,637 L182F probably damaging Het
Foxf1 T C 8: 121,085,162 V255A probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
Gzf1 C T 2: 148,684,766 R386C probably damaging Het
H2-Aa T A 17: 34,287,721 T16S possibly damaging Het
Hdgfrp2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mrgprb2 A T 7: 48,552,019 S319R probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nelfa A T 5: 33,921,907 N107K possibly damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prdm10 G A 9: 31,346,967 A514T probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Ptp4a3 T G 15: 73,756,846 Y152D probably damaging Het
Raph1 A G 1: 60,499,620 C389R unknown Het
Rcc1 T C 4: 132,335,785 E170G probably benign Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tex40 A G 19: 6,922,652 S162P possibly damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vmn1r174 A T 7: 23,754,671 D254V probably damaging Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in Mtrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Mtrr APN 13 68571147 missense probably damaging 1.00
IGL01806:Mtrr APN 13 68580600 missense possibly damaging 0.92
IGL01808:Mtrr APN 13 68566093 missense probably benign 0.00
IGL01875:Mtrr APN 13 68572609 missense probably damaging 1.00
IGL02137:Mtrr APN 13 68568801 missense possibly damaging 0.75
IGL02186:Mtrr APN 13 68564357 missense probably benign
IGL03114:Mtrr APN 13 68564322 nonsense probably null
3-1:Mtrr UTSW 13 68575016 critical splice donor site probably null
H8562:Mtrr UTSW 13 68564377 missense probably damaging 0.97
N/A:Mtrr UTSW 13 68575397 splice site probably benign
R0007:Mtrr UTSW 13 68575330 missense probably benign 0.02
R0741:Mtrr UTSW 13 68579539 splice site probably null
R2140:Mtrr UTSW 13 68568940 missense possibly damaging 0.47
R2513:Mtrr UTSW 13 68566973 nonsense probably null
R4604:Mtrr UTSW 13 68564512 splice site probably null
R5501:Mtrr UTSW 13 68579647 missense probably damaging 1.00
R5658:Mtrr UTSW 13 68568915 missense possibly damaging 0.67
R6477:Mtrr UTSW 13 68570073 missense probably damaging 1.00
R6694:Mtrr UTSW 13 68564333 missense probably benign
R6979:Mtrr UTSW 13 68570003 critical splice donor site probably null
R7094:Mtrr UTSW 13 68579684 missense possibly damaging 0.83
R7296:Mtrr UTSW 13 68568860 nonsense probably null
R7354:Mtrr UTSW 13 68566207 missense probably damaging 1.00
R7378:Mtrr UTSW 13 68564402 missense probably damaging 1.00
R7546:Mtrr UTSW 13 68582149 unclassified probably benign
R7562:Mtrr UTSW 13 68566217 missense probably damaging 0.96
R7759:Mtrr UTSW 13 68570027 missense probably damaging 1.00
R7975:Mtrr UTSW 13 68579547 splice site probably null
R8101:Mtrr UTSW 13 68577621 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCACTCAAGAGGAACGAG -3'
(R):5'- CTGGATAGTTGTAAGCCTAGGG -3'

Sequencing Primer
(F):5'- CACTCAAGAGGAACGAGGCGAG -3'
(R):5'- GTCTCAGCAACTTCTTAATGTGG -3'
Posted On2020-07-13