Incidental Mutation 'R0693:Garnl3'
ID63392
Institutional Source Beutler Lab
Gene Symbol Garnl3
Ensembl Gene ENSMUSG00000038860
Gene NameGTPase activating RANGAP domain-like 3
Synonyms
MMRRC Submission 038878-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R0693 (G1)
Quality Score152
Status Not validated
Chromosome2
Chromosomal Location32986224-33131654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33085907 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 16 (F16L)
Ref Sequence ENSEMBL: ENSMUSP00000099874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000124000] [ENSMUST00000127509] [ENSMUST00000133135] [ENSMUST00000137381]
Predicted Effect probably damaging
Transcript: ENSMUST00000049618
AA Change: F20L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: F20L

DomainStartEndE-ValueType
Pfam:Rap_GAP 202 383 3.4e-73 PFAM
Pfam:CNH 475 780 3.5e-67 PFAM
low complexity region 793 804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102810
AA Change: F16L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: F16L

DomainStartEndE-ValueType
Pfam:Rap_GAP 198 385 4.6e-67 PFAM
Pfam:CNH 471 776 1.8e-68 PFAM
low complexity region 789 800 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124000
AA Change: F101L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123601
Gene: ENSMUSG00000038860
AA Change: F101L

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127509
Predicted Effect possibly damaging
Transcript: ENSMUST00000133135
AA Change: F61L

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135296
Predicted Effect probably damaging
Transcript: ENSMUST00000137381
AA Change: F61L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148043
Meta Mutation Damage Score 0.1021 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 A T 9: 43,018,401 N199K probably damaging Het
Ccnj T A 19: 40,837,107 L87H probably damaging Het
Cntn3 T C 6: 102,168,947 T978A possibly damaging Het
Gbgt1 G A 2: 28,504,830 G160D probably damaging Het
Gm5114 T C 7: 39,408,764 D477G probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Inpp4b A T 8: 81,997,314 T492S probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Msl3l2 G A 10: 56,115,851 R224Q possibly damaging Het
Nfe2l3 A G 6: 51,433,054 T50A possibly damaging Het
Olfr850 G A 9: 19,477,972 Q90* probably null Het
Olfr889 A G 9: 38,116,029 T78A probably benign Het
Prkg1 T A 19: 30,594,978 Q426L probably benign Het
Rnf215 G A 11: 4,140,401 probably null Het
Sp100 T A 1: 85,667,005 probably null Het
Tbc1d21 G A 9: 58,361,287 T263M probably damaging Het
Tenm2 G A 11: 36,024,809 T1966M probably damaging Het
Tnni3k T C 3: 154,961,972 Y268C probably damaging Het
Usp34 A G 11: 23,452,637 T2477A probably damaging Het
Other mutations in Garnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Garnl3 APN 2 33006816 missense probably damaging 1.00
IGL01601:Garnl3 APN 2 32997689 nonsense probably null
IGL01981:Garnl3 APN 2 32997729 missense probably damaging 0.98
IGL02209:Garnl3 APN 2 33085930 missense probably damaging 0.99
IGL02434:Garnl3 APN 2 33054205 missense probably damaging 1.00
IGL02512:Garnl3 APN 2 33031138 missense probably damaging 1.00
IGL02947:Garnl3 APN 2 33046594 missense probably damaging 1.00
PIT4403001:Garnl3 UTSW 2 32990758 missense probably damaging 1.00
R0123:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0134:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0225:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0551:Garnl3 UTSW 2 33016738 missense probably damaging 1.00
R0691:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0737:Garnl3 UTSW 2 32990642 missense probably damaging 0.98
R1350:Garnl3 UTSW 2 33052214 missense probably damaging 1.00
R1691:Garnl3 UTSW 2 32997663 nonsense probably null
R1791:Garnl3 UTSW 2 33034127 missense probably benign 0.02
R1938:Garnl3 UTSW 2 33005200 missense probably damaging 0.99
R2100:Garnl3 UTSW 2 33046645 missense probably benign 0.35
R2316:Garnl3 UTSW 2 33005152 missense probably damaging 1.00
R2353:Garnl3 UTSW 2 33064034 missense probably damaging 1.00
R3161:Garnl3 UTSW 2 33034711 missense probably damaging 1.00
R3839:Garnl3 UTSW 2 32989546 missense probably benign 0.00
R3847:Garnl3 UTSW 2 32992228 missense probably benign
R4871:Garnl3 UTSW 2 33087088 start codon destroyed probably null 0.77
R5682:Garnl3 UTSW 2 33054173 missense probably damaging 1.00
R5811:Garnl3 UTSW 2 33006899 missense probably damaging 0.99
R6267:Garnl3 UTSW 2 33104880 missense probably benign 0.20
R6502:Garnl3 UTSW 2 33006821 missense possibly damaging 0.67
R6532:Garnl3 UTSW 2 33031119 missense possibly damaging 0.87
R6639:Garnl3 UTSW 2 32989525 missense possibly damaging 0.75
R6763:Garnl3 UTSW 2 33054196 missense probably damaging 1.00
R6866:Garnl3 UTSW 2 33002773 splice site probably null
R6913:Garnl3 UTSW 2 32986829 missense possibly damaging 0.91
R7002:Garnl3 UTSW 2 33054193 missense possibly damaging 0.65
R7168:Garnl3 UTSW 2 32995078 missense probably damaging 1.00
R7341:Garnl3 UTSW 2 33034129 missense probably damaging 1.00
R7746:Garnl3 UTSW 2 32992257 missense probably damaging 1.00
R7919:Garnl3 UTSW 2 33046599 missense probably benign 0.38
R8079:Garnl3 UTSW 2 33018499 critical splice donor site probably null
R8087:Garnl3 UTSW 2 33045536 missense probably benign 0.01
R8123:Garnl3 UTSW 2 33104938 missense probably damaging 0.97
R8170:Garnl3 UTSW 2 33015223 missense possibly damaging 0.88
R8347:Garnl3 UTSW 2 33085891 missense probably damaging 1.00
R8418:Garnl3 UTSW 2 33052146 missense possibly damaging 0.73
R8679:Garnl3 UTSW 2 33026094 missense probably damaging 1.00
R8940:Garnl3 UTSW 2 33005229 critical splice acceptor site probably null
X0022:Garnl3 UTSW 2 33022668 missense probably damaging 1.00
X0023:Garnl3 UTSW 2 33026149 missense probably damaging 1.00
X0024:Garnl3 UTSW 2 33005179 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACCATAACCTTTCAGCATCACTGAC -3'
(R):5'- CAAACCTGTTTCATAGCAGCCGTTTC -3'

Sequencing Primer
(F):5'- TCAGCATCACTGACTTAAATTAAACC -3'
(R):5'- GCCGTTTCTTtttctttttctctttc -3'
Posted On2013-07-30