Incidental Mutation 'R8168:Ptp4a3'
ID633920
Institutional Source Beutler Lab
Gene Symbol Ptp4a3
Ensembl Gene ENSMUSG00000059895
Gene Nameprotein tyrosine phosphatase 4a3
SynonymsPrl-3
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001166388.1; MGI: 1277098

Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R8168 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location73723145-73758766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 73756846 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 152 (Y152D)
Ref Sequence ENSEMBL: ENSMUSP00000060956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053232] [ENSMUST00000151999] [ENSMUST00000163582] [ENSMUST00000165541] [ENSMUST00000167582]
Predicted Effect probably damaging
Transcript: ENSMUST00000053232
AA Change: Y152D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060956
Gene: ENSMUSG00000059895
AA Change: Y152D

DomainStartEndE-ValueType
Pfam:DSPc 26 155 7.1e-10 PFAM
Pfam:Y_phosphatase 27 153 3.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151999
SMART Domains Protein: ENSMUSP00000118236
Gene: ENSMUSG00000072487

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
SCOP:d1gw5a_ 294 635 1e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163582
AA Change: Y152D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131281
Gene: ENSMUSG00000059895
AA Change: Y152D

DomainStartEndE-ValueType
Pfam:DSPc 26 155 7.1e-10 PFAM
Pfam:Y_phosphatase 27 153 3.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165541
AA Change: Y152D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132097
Gene: ENSMUSG00000059895
AA Change: Y152D

DomainStartEndE-ValueType
Pfam:Y_phosphatase 13 152 5.1e-9 PFAM
Pfam:DSPc 34 154 4.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167582
AA Change: Y133D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131036
Gene: ENSMUSG00000059895
AA Change: Y133D

DomainStartEndE-ValueType
Pfam:Y_phosphatase 5 134 7.8e-12 PFAM
Pfam:DSPc 5 136 1.8e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. Protein tyrosine phosphatases are cell signaling molecules that play regulatory roles in a variety of cellular processes. Studies of this class of protein tyrosine phosphatase in mice demonstrates that they are prenylated in vivo, suggesting their association with cell plasma membrane. The encoded protein may enhance cell proliferation, and overexpression of this gene has been implicated in tumor metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality and decreased incidence of AOM-DDS induced tumors. Mice homozygous for a different targeted allele exhibit decreased circulating glucose levels in an intraperitoneal glucose tolerance test. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(9)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
9430020K01Rik A T 18: 4,675,094 D952V probably benign Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Atp6v1b2 T C 8: 69,108,331 S404P possibly damaging Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
D230025D16Rik C T 8: 105,248,769 P330L probably benign Het
Dock5 A T 14: 67,770,197 probably null Het
Flrt1 G A 19: 7,096,637 L182F probably damaging Het
Foxf1 T C 8: 121,085,162 V255A probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
Gzf1 C T 2: 148,684,766 R386C probably damaging Het
H2-Aa T A 17: 34,287,721 T16S possibly damaging Het
Hdgfrp2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mrgprb2 A T 7: 48,552,019 S319R probably benign Het
Mtrr C T 13: 68,572,613 V288I probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nelfa A T 5: 33,921,907 N107K possibly damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prdm10 G A 9: 31,346,967 A514T probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Raph1 A G 1: 60,499,620 C389R unknown Het
Rcc1 T C 4: 132,335,785 E170G probably benign Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tex40 A G 19: 6,922,652 S162P possibly damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vmn1r174 A T 7: 23,754,671 D254V probably damaging Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in Ptp4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0005:Ptp4a3 UTSW 15 73755311 missense possibly damaging 0.95
R2033:Ptp4a3 UTSW 15 73753769 missense probably damaging 1.00
R2159:Ptp4a3 UTSW 15 73752016 missense probably benign 0.00
R5976:Ptp4a3 UTSW 15 73756036 missense possibly damaging 0.89
R6874:Ptp4a3 UTSW 15 73723410 unclassified probably benign
R7894:Ptp4a3 UTSW 15 73756907 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCTTCATGAAATCCAGGCTTC -3'
(R):5'- TTCAGAAAGACAGCCGTGG -3'

Sequencing Primer
(F):5'- TCTCCCAGAGTACCAGCTTAG -3'
(R):5'- CAGCCGTGGGTACAGATG -3'
Posted On2020-07-13