Incidental Mutation 'R8168:H2-Aa'
ID633921
Institutional Source Beutler Lab
Gene Symbol H2-Aa
Ensembl Gene ENSMUSG00000036594
Gene Namehistocompatibility 2, class II antigen A, alpha
SynonymsH-2Aa, I-Aalpha, Ia-1, Aalpha, Ia1, A alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8168 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34282744-34287827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34287721 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 16 (T16S)
Ref Sequence ENSEMBL: ENSMUSP00000046105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040655] [ENSMUST00000174751]
PDB Structure
CRYSTAL STRUCTURE OF CLASS II MHC MOLECULE IAb BOUND TO EALPHA3K PEPTIDE [X-RAY DIFFRACTION]
Crystal structure of murine class II MHC I-Ab in complex with a human CLIP peptide [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR B3K506 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR YAe62 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR 2W20 [X-RAY DIFFRACTION]
Crystal Structure of 809.B5 TCR complexed with MHC Class II I-Ab/3k peptide [X-RAY DIFFRACTION]
J809.B5 TCR bound to IAb/3K [X-RAY DIFFRACTION]
J809.B5 Y31A TCR bound to IAb3K [X-RAY DIFFRACTION]
14.C6 TCR complexed with MHC class II I-Ab/3K peptide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040655
AA Change: T16S

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046105
Gene: ENSMUSG00000036594
AA Change: T16S

DomainStartEndE-ValueType
MHC_II_alpha 31 111 1.83e-45 SMART
IGc1 129 200 2.51e-27 SMART
Pfam:C1-set_C 203 255 2.1e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174751
AA Change: T16S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133399
Gene: ENSMUSG00000036594
AA Change: T16S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc1 46 117 2.51e-27 SMART
low complexity region 141 158 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DQA1 belongs to the HLA class II alpha chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B Lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa. It is encoded by 5 exons; exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack cell surface expression of MHC class II molecules on macrophages and show decreased CD4-positive T cell number, increased CD8-positive T cell number, thymus hyperplasia, enlarged lymph nodes, and altered splenocyte response to staphylococcal enterotoxin B. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
9430020K01Rik A T 18: 4,675,094 D952V probably benign Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Atp6v1b2 T C 8: 69,108,331 S404P possibly damaging Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
D230025D16Rik C T 8: 105,248,769 P330L probably benign Het
Dock5 A T 14: 67,770,197 probably null Het
Flrt1 G A 19: 7,096,637 L182F probably damaging Het
Foxf1 T C 8: 121,085,162 V255A probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
Gzf1 C T 2: 148,684,766 R386C probably damaging Het
Hdgfrp2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mrgprb2 A T 7: 48,552,019 S319R probably benign Het
Mtrr C T 13: 68,572,613 V288I probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nelfa A T 5: 33,921,907 N107K possibly damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prdm10 G A 9: 31,346,967 A514T probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Ptp4a3 T G 15: 73,756,846 Y152D probably damaging Het
Raph1 A G 1: 60,499,620 C389R unknown Het
Rcc1 T C 4: 132,335,785 E170G probably benign Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tex40 A G 19: 6,922,652 S162P possibly damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vmn1r174 A T 7: 23,754,671 D254V probably damaging Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in H2-Aa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:H2-Aa APN 17 34284530 missense probably damaging 1.00
citation UTSW 17 34287677 splice site probably null
R1556:H2-Aa UTSW 17 34284416 missense possibly damaging 0.94
R1901:H2-Aa UTSW 17 34283233 missense possibly damaging 0.65
R2144:H2-Aa UTSW 17 34283827 missense probably damaging 1.00
R4816:H2-Aa UTSW 17 34283820 missense probably damaging 1.00
R5607:H2-Aa UTSW 17 34283842 missense possibly damaging 0.89
R5608:H2-Aa UTSW 17 34283842 missense possibly damaging 0.89
R6264:H2-Aa UTSW 17 34283198 missense probably damaging 0.98
R6822:H2-Aa UTSW 17 34287677 splice site probably null
R6917:H2-Aa UTSW 17 34283707 missense probably damaging 1.00
R7052:H2-Aa UTSW 17 34284510 missense possibly damaging 0.50
R7116:H2-Aa UTSW 17 34283627 nonsense probably null
R8257:H2-Aa UTSW 17 34283237 missense probably damaging 0.97
R8264:H2-Aa UTSW 17 34287735 missense probably benign 0.18
X0063:H2-Aa UTSW 17 34287811 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGATTGTGAGCTGACCAACC -3'
(R):5'- CTCTTCCAGGCCTCCTAATACAAAG -3'

Sequencing Primer
(F):5'- CAGAGCCTCCTGAAGAATGGATC -3'
(R):5'- AGCTGGCAACTTTGACGTC -3'
Posted On2020-07-13