Mutagenetix > Incidental Mutations

Incidental Mutation 'R8168:Nlrc4'

633923

Institutional Source

Beutler Lab

Gene Symbol

Nlrc4

Ensembl Gene

ENSMUSG00000039193

Gene Name

NLR family, CARD domain containing 4

Synonyms

Card12, Ipaf, 9530011P19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R8168 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74426295-74459108 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74445211 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 726 (T726A)

Ref Sequence

ENSEMBL: ENSMUSP00000059637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052124]

PDB Structure

Crystal structure of NLRC4 reveals its autoinhibition mechanism [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000052124
AA Change: T726A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000059637
Gene: ENSMUSG00000039193
AA Change: T726A

Domain	Start	End	E-Value	Type
Pfam:CARD	1	87	1.4e-20	PFAM
Pfam:NACHT	163	314	1.3e-28	PFAM
SCOP:d1yrga_	734	1015	3e-20	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. Family members play essential roles in innate immune response to a wide range of pathogenic organisms, tissue damage and other cellular stresses. Mutations in this gene result in autoinflammation with infantile enterocolitis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null allele show lack of caspase-1 activation in macrophages infected with Legionella and Salmonella, and enhanced permissivity to Legionella replication. Homozygotes for another null allele fail to show caspase dependent cell death andIL-1beta secretion upon Salmonella infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	G	A	10: 77,982,944	A150T	probably benign	Het
9430020K01Rik	A	T	18: 4,675,094	D952V	probably benign	Het
AI607873	A	C	1: 173,729,938	S411R	probably benign	Het
Ano4	A	G	10: 88,980,995	I652T	probably damaging	Het
Arhgef1	A	G	7: 24,925,406	T862A	probably benign	Het
Atp6v1b2	T	C	8: 69,108,331	S404P	possibly damaging	Het
Cfap54	A	T	10: 92,908,877	S2170T	unknown	Het
Copa	A	T	1: 172,099,672	H204L	probably damaging	Het
Cwc22	A	C	2: 77,927,271	V171G	probably damaging	Het
D230025D16Rik	C	T	8: 105,248,769	P330L	probably benign	Het
Dock5	A	T	14: 67,770,197		probably null	Het
Flrt1	G	A	19: 7,096,637	L182F	probably damaging	Het
Foxf1	T	C	8: 121,085,162	V255A	probably damaging	Het
Gnptab	G	T	10: 88,419,133	A194S	probably benign	Het
Gzf1	C	T	2: 148,684,766	R386C	probably damaging	Het
H2-Aa	T	A	17: 34,287,721	T16S	possibly damaging	Het
Hdgfrp2	T	C	17: 56,082,282	F52S	probably damaging	Het
Htt	A	G	5: 34,882,956	N2154S	probably benign	Het
Lama3	T	A	18: 12,506,942	W65R	probably null	Het
Mef2c	G	T	13: 83,656,350	L356F	probably damaging	Het
Mrgprb2	A	T	7: 48,552,019	S319R	probably benign	Het
Mtrr	C	T	13: 68,572,613	V288I	probably benign	Het
Myo18a	T	A	11: 77,821,142	I713N	probably damaging	Het
Nelfa	A	T	5: 33,921,907	N107K	possibly damaging	Het
Nim1k	A	T	13: 119,712,752	V202D	probably damaging	Het
Olfr1154	T	A	2: 87,903,199	H159L	probably damaging	Het
Olfr1208	T	A	2: 88,896,776	M274L	probably benign	Het
Prdm10	G	A	9: 31,346,967	A514T	probably benign	Het
Prg4	T	A	1: 150,455,850	E357D	unknown	Het
Ptp4a3	T	G	15: 73,756,846	Y152D	probably damaging	Het
Raph1	A	G	1: 60,499,620	C389R	unknown	Het
Rcc1	T	C	4: 132,335,785	E170G	probably benign	Het
Spag17	C	T	3: 100,034,984	T775M	possibly damaging	Het
Srcap	T	A	7: 127,542,523	V1825D	probably damaging	Het
Tex40	A	G	19: 6,922,652	S162P	possibly damaging	Het
Tshr	T	A	12: 91,511,965	H195Q	probably benign	Het
Vmn1r174	A	T	7: 23,754,671	D254V	probably damaging	Het
Vps13a	A	C	19: 16,749,548	I244M	probably benign	Het

Other mutations in Nlrc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Nlrc4	APN	17	74446534	missense	probably benign	0.02
IGL00427:Nlrc4	APN	17	74447092	missense	probably benign
IGL00823:Nlrc4	APN	17	74447990	missense	probably benign	0.01
IGL01404:Nlrc4	APN	17	74445711	missense	probably damaging	1.00
IGL02178:Nlrc4	APN	17	74446843	missense	probably damaging	1.00
IGL02266:Nlrc4	APN	17	74446167	missense	possibly damaging	0.72
IGL03342:Nlrc4	APN	17	74445318	missense	probably damaging	1.00
Inwood	UTSW	17	74445630	missense	probably damaging	1.00
PIT4305001:Nlrc4	UTSW	17	74446309	missense	probably damaging	0.99
PIT4466001:Nlrc4	UTSW	17	74427119	missense	probably benign	0.01
R0077:Nlrc4	UTSW	17	74446831	missense	probably damaging	1.00
R0398:Nlrc4	UTSW	17	74445920	missense	probably damaging	0.99
R0639:Nlrc4	UTSW	17	74426963	missense	probably benign	0.16
R1498:Nlrc4	UTSW	17	74446413	missense	probably benign	0.43
R1565:Nlrc4	UTSW	17	74441931	missense	probably benign	0.00
R1624:Nlrc4	UTSW	17	74445189	missense	possibly damaging	0.55
R1666:Nlrc4	UTSW	17	74445906	missense	probably damaging	0.97
R1668:Nlrc4	UTSW	17	74445906	missense	probably damaging	0.97
R1690:Nlrc4	UTSW	17	74437523	nonsense	probably null
R1723:Nlrc4	UTSW	17	74441908	missense	probably damaging	1.00
R1988:Nlrc4	UTSW	17	74426943	missense	probably benign	0.09
R1992:Nlrc4	UTSW	17	74445633	missense	probably benign	0.04
R2141:Nlrc4	UTSW	17	74447951	splice site	probably benign
R2256:Nlrc4	UTSW	17	74445630	missense	probably damaging	1.00
R2897:Nlrc4	UTSW	17	74448045	missense	probably benign
R3117:Nlrc4	UTSW	17	74436068	missense	probably benign	0.00
R3861:Nlrc4	UTSW	17	74445621	missense	probably benign	0.00
R4093:Nlrc4	UTSW	17	74445958	missense	probably benign	0.20
R4212:Nlrc4	UTSW	17	74447115	missense	possibly damaging	0.66
R4627:Nlrc4	UTSW	17	74446628	missense	probably damaging	1.00
R4859:Nlrc4	UTSW	17	74436037	missense	probably damaging	0.97
R4968:Nlrc4	UTSW	17	74446941	missense	probably benign	0.20
R5133:Nlrc4	UTSW	17	74446717	missense	possibly damaging	0.91
R5379:Nlrc4	UTSW	17	74448083	nonsense	probably null
R6045:Nlrc4	UTSW	17	74446959	missense	probably damaging	0.98
R6654:Nlrc4	UTSW	17	74445528	missense	possibly damaging	0.55
R6712:Nlrc4	UTSW	17	74446836	missense	probably damaging	0.96
R6976:Nlrc4	UTSW	17	74445939	missense	probably damaging	1.00
R7030:Nlrc4	UTSW	17	74446006	missense	probably damaging	1.00
R7153:Nlrc4	UTSW	17	74447103	missense	possibly damaging	0.84
R7190:Nlrc4	UTSW	17	74445203	missense	probably damaging	1.00
R7398:Nlrc4	UTSW	17	74446542	missense	probably damaging	1.00
R7417:Nlrc4	UTSW	17	74446488	missense	probably benign	0.18
R7468:Nlrc4	UTSW	17	74445512	missense	probably benign	0.00
R7639:Nlrc4	UTSW	17	74447957	critical splice donor site	probably null
R7716:Nlrc4	UTSW	17	74446656	missense	probably damaging	1.00
R7757:Nlrc4	UTSW	17	74448196	missense	probably benign	0.00
R7868:Nlrc4	UTSW	17	74448052	missense	possibly damaging	0.75
R7890:Nlrc4	UTSW	17	74437508	missense	probably benign	0.00
R7920:Nlrc4	UTSW	17	74427119	missense	probably benign	0.01
R7950:Nlrc4	UTSW	17	74445615	missense	probably damaging	1.00
R8154:Nlrc4	UTSW	17	74445909	missense	probably damaging	1.00
R8311:Nlrc4	UTSW	17	74446545	missense	probably damaging	1.00
X0026:Nlrc4	UTSW	17	74446643	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATAAGCCAGGCTCTGTGGTG -3'
(R):5'- ACTCTAGAGGTCACACTCCGAG -3'

Sequencing Primer
(F):5'- GTGCGCCCAGGACGTAAAAC -3'
(R):5'- TAGAGGTCACACTCCGAGATATTAAC -3'

Posted On

2020-07-13