Incidental Mutation 'R8168:Flrt1'
ID633927
Institutional Source Beutler Lab
Gene Symbol Flrt1
Ensembl Gene ENSMUSG00000047787
Gene Namefibronectin leucine rich transmembrane protein 1
SynonymsD630040I23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R8168 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location7092014-7105729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7096637 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 182 (L182F)
Ref Sequence ENSEMBL: ENSMUSP00000109010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040261] [ENSMUST00000113383]
Predicted Effect probably benign
Transcript: ENSMUST00000040261
SMART Domains Protein: ENSMUSP00000039507
Gene: ENSMUSG00000036278

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 25 41 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
A1pp 151 281 7.67e-46 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113383
AA Change: L182F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109010
Gene: ENSMUSG00000047787
AA Change: L182F

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRRNT 53 85 4.11e-6 SMART
LRR 127 149 2.61e1 SMART
LRR 150 175 4.71e1 SMART
LRR 177 199 1.76e1 SMART
LRR 200 220 7.36e0 SMART
LRR 221 246 1.49e1 SMART
LRR 247 270 9.77e1 SMART
LRR 271 292 1.53e1 SMART
LRR_TYP 293 316 3.55e-6 SMART
LRRCT 328 379 5.19e-9 SMART
low complexity region 381 392 N/A INTRINSIC
FN3 434 515 1.49e0 SMART
transmembrane domain 556 578 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. The family members may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. The encoded protein shares sequence similarity with two other family members, FLRT2 and FLRT3. This gene is expressed in kidney and brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
9430020K01Rik A T 18: 4,675,094 D952V probably benign Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Atp6v1b2 T C 8: 69,108,331 S404P possibly damaging Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
D230025D16Rik C T 8: 105,248,769 P330L probably benign Het
Dock5 A T 14: 67,770,197 probably null Het
Foxf1 T C 8: 121,085,162 V255A probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
Gzf1 C T 2: 148,684,766 R386C probably damaging Het
H2-Aa T A 17: 34,287,721 T16S possibly damaging Het
Hdgfrp2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mrgprb2 A T 7: 48,552,019 S319R probably benign Het
Mtrr C T 13: 68,572,613 V288I probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nelfa A T 5: 33,921,907 N107K possibly damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prdm10 G A 9: 31,346,967 A514T probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Ptp4a3 T G 15: 73,756,846 Y152D probably damaging Het
Raph1 A G 1: 60,499,620 C389R unknown Het
Rcc1 T C 4: 132,335,785 E170G probably benign Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tex40 A G 19: 6,922,652 S162P possibly damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vmn1r174 A T 7: 23,754,671 D254V probably damaging Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in Flrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Flrt1 APN 19 7096912 missense probably damaging 1.00
IGL01082:Flrt1 APN 19 7095974 missense probably benign
IGL02535:Flrt1 APN 19 7096733 missense probably benign 0.00
R0240:Flrt1 UTSW 19 7097110 intron probably benign
R0240:Flrt1 UTSW 19 7097110 intron probably benign
R0403:Flrt1 UTSW 19 7095919 missense probably benign 0.01
R0645:Flrt1 UTSW 19 7097143 intron probably benign
R0677:Flrt1 UTSW 19 7096179 nonsense probably null
R1818:Flrt1 UTSW 19 7095346 missense probably damaging 1.00
R2191:Flrt1 UTSW 19 7095829 missense probably damaging 0.99
R2228:Flrt1 UTSW 19 7095358 missense probably damaging 1.00
R2471:Flrt1 UTSW 19 7096491 missense probably damaging 1.00
R4978:Flrt1 UTSW 19 7096876 missense probably damaging 1.00
R5460:Flrt1 UTSW 19 7095740 missense probably damaging 0.99
R5630:Flrt1 UTSW 19 7096465 missense probably damaging 1.00
R6326:Flrt1 UTSW 19 7096609 missense probably damaging 1.00
R6734:Flrt1 UTSW 19 7096159 missense possibly damaging 0.91
R6905:Flrt1 UTSW 19 7095392 nonsense probably null
R7239:Flrt1 UTSW 19 7095964 missense probably benign 0.12
R7799:Flrt1 UTSW 19 7095864 missense possibly damaging 0.78
X0024:Flrt1 UTSW 19 7095749 missense probably damaging 1.00
X0062:Flrt1 UTSW 19 7096879 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGGTGTCGTCGGCAATG -3'
(R):5'- TCATCTACCTGTATGAGAATGACCTG -3'

Sequencing Primer
(F):5'- CGGCAATGCGCTGGTTG -3'
(R):5'- GAATGACCTGGACGAGTTCCCTATC -3'
Posted On2020-07-13