Incidental Mutation 'R8169:Lrrc14b'
ID633992
Institutional Source Beutler Lab
Gene Symbol Lrrc14b
Ensembl Gene ENSMUSG00000021579
Gene Nameleucine rich repeat containing 14B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8169 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location74359578-74364005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 74363167 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 265 (T265P)
Ref Sequence ENSEMBL: ENSMUSP00000022064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022063] [ENSMUST00000022064] [ENSMUST00000159931] [ENSMUST00000160021] [ENSMUST00000162672]
Predicted Effect probably benign
Transcript: ENSMUST00000022063
SMART Domains Protein: ENSMUSP00000022063
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
coiled coil region 78 140 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000022064
AA Change: T265P

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022064
Gene: ENSMUSG00000021579
AA Change: T265P

DomainStartEndE-ValueType
SCOP:d1a4ya_ 208 417 8e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159931
SMART Domains Protein: ENSMUSP00000124009
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
coiled coil region 78 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160021
SMART Domains Protein: ENSMUSP00000124193
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
coiled coil region 78 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162672
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik C A 5: 139,364,057 G79V probably damaging Het
4930562C15Rik T A 16: 4,866,218 Y226N probably benign Het
6430573F11Rik A T 8: 36,511,703 K153N probably damaging Het
Bach1 G A 16: 87,722,502 C560Y possibly damaging Het
BC049730 T A 7: 24,712,575 M60K probably benign Het
Capn13 T A 17: 73,326,472 probably null Het
Casq2 G T 3: 102,110,312 A103S possibly damaging Het
Cfap100 A G 6: 90,417,674 F57S Het
Clca2 A T 3: 145,077,892 L654Q probably damaging Het
Cntnap5c T A 17: 58,104,770 probably null Het
Crtc2 G C 3: 90,263,576 G652A probably damaging Het
Csnk1g2 A G 10: 80,639,802 D401G probably damaging Het
Dars T C 1: 128,376,265 N242D probably null Het
Dnah10 T C 5: 124,800,882 L2677P probably damaging Het
Dnal1 G A 12: 84,124,556 A3T probably benign Het
Dpep2 C T 8: 105,996,217 V60I Het
Ehmt2 T A 17: 34,903,363 I302N probably benign Het
Eif3a C T 19: 60,762,190 R1309Q unknown Het
Eno4 T A 19: 58,946,652 Y100N probably benign Het
Ephx2 A T 14: 66,112,153 probably null Het
Fam102a T C 2: 32,563,748 I203T probably benign Het
Fbxw14 A T 9: 109,277,216 I251K probably benign Het
Fcgbp T C 7: 28,085,494 probably null Het
Foxm1 A C 6: 128,371,708 probably null Het
Fscn3 T A 6: 28,430,329 I166N possibly damaging Het
Gdpd4 G T 7: 97,972,128 V193L probably benign Het
Gm9573 T C 17: 35,621,180 T705A unknown Het
Gnpat T G 8: 124,880,130 C352G probably benign Het
H2-Q7 T A 17: 35,439,934 Y120* probably null Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Klri1 G A 6: 129,717,107 R6C probably benign Het
Kmo T C 1: 175,649,163 V154A probably benign Het
Kmt2c A G 5: 25,354,687 L1031P probably damaging Het
Lrrc2 C T 9: 110,980,886 T330I probably benign Het
Lyn T A 4: 3,783,050 S428T probably damaging Het
Mfsd8 T A 3: 40,837,115 M59L probably benign Het
Mok T A 12: 110,808,365 Q341L probably benign Het
Myh3 C A 11: 67,089,030 N598K probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp4e A G 7: 23,320,506 I139M probably benign Het
Olfr139 T A 11: 74,044,881 Q131L possibly damaging Het
Olfr142 G A 2: 90,252,098 R297* probably null Het
Olfr577 A G 7: 102,973,338 L218P probably damaging Het
Olfr667 A T 7: 104,916,412 Y295N possibly damaging Het
Olfr741 T C 14: 50,486,235 V259A probably benign Het
Osbpl7 G A 11: 97,054,850 S312N probably damaging Het
Paxip1 A G 5: 27,772,095 L323P unknown Het
Pcdh18 T A 3: 49,745,235 H926L probably damaging Het
Pcm1 T G 8: 41,310,116 S1460R possibly damaging Het
Pdha2 A G 3: 141,211,394 S118P possibly damaging Het
Pdss1 A T 2: 22,901,812 Y86F probably benign Het
Ppargc1a A T 5: 51,473,684 D534E probably benign Het
Prune2 A G 19: 17,125,091 K2538R probably benign Het
Ptprq A T 10: 107,582,490 I1675N probably damaging Het
Rgma C T 7: 73,375,882 P3L probably benign Het
Ros1 A G 10: 52,064,672 probably null Het
Rsg1 A G 4: 141,218,219 H127R probably damaging Het
Sema4g C T 19: 44,998,971 R519W probably damaging Het
Serpinc1 T A 1: 160,993,401 F139L probably damaging Het
Slc22a29 A G 19: 8,207,332 I198T probably damaging Het
Slc4a5 T C 6: 83,303,391 V1007A probably benign Het
Sptbn1 T C 11: 30,197,783 Y17C possibly damaging Het
Tex261 C A 6: 83,775,017 probably null Het
Timmdc1 T A 16: 38,510,786 T128S probably benign Het
Tmem120b C A 5: 123,099,936 Y96* probably null Het
Tmem196 T A 12: 120,018,576 F182I possibly damaging Het
Tnxb G A 17: 34,699,207 V2365M possibly damaging Het
Tph1 T C 7: 46,653,809 silent Het
Trpc1 G A 9: 95,710,270 Q551* probably null Het
Tubgcp3 T C 8: 12,616,099 N828D probably benign Het
Unc13a C A 8: 71,656,289 G478W probably damaging Het
Usp15 T A 10: 123,125,893 T627S Het
Vmn1r115 A T 7: 20,844,219 I256N probably damaging Het
Vmn2r6 T A 3: 64,539,889 K585N probably benign Het
Vsir G T 10: 60,358,268 probably null Het
Xirp2 A G 2: 67,513,199 D1928G probably benign Het
Xylt1 A G 7: 117,650,619 Y672C probably damaging Het
Yrdc A G 4: 124,851,087 S105G probably benign Het
Zfc3h1 T A 10: 115,418,711 N1403K probably damaging Het
Zfp160 A T 17: 21,027,036 H616L probably damaging Het
Zfp637 T A 6: 117,845,291 F127I probably damaging Het
Zfp69 G T 4: 120,930,534 A528D probably damaging Het
Zpr1 T A 9: 46,278,347 L342Q possibly damaging Het
Other mutations in Lrrc14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Lrrc14b APN 13 74360959 missense probably damaging 0.97
IGL01521:Lrrc14b APN 13 74363572 missense probably damaging 1.00
IGL03156:Lrrc14b APN 13 74363904 missense probably benign
R0457:Lrrc14b UTSW 13 74361160 missense probably benign 0.41
R1631:Lrrc14b UTSW 13 74361254 splice site probably null
R1741:Lrrc14b UTSW 13 74363586 missense probably damaging 1.00
R2042:Lrrc14b UTSW 13 74363442 missense probably benign 0.00
R2047:Lrrc14b UTSW 13 74363442 missense probably benign 0.00
R2149:Lrrc14b UTSW 13 74363757 missense possibly damaging 0.63
R3083:Lrrc14b UTSW 13 74363218 missense possibly damaging 0.63
R3838:Lrrc14b UTSW 13 74363545 missense possibly damaging 0.86
R3892:Lrrc14b UTSW 13 74363668 missense probably benign 0.00
R5748:Lrrc14b UTSW 13 74363640 missense probably damaging 1.00
R6508:Lrrc14b UTSW 13 74363218 missense possibly damaging 0.63
R6663:Lrrc14b UTSW 13 74361361 missense probably damaging 1.00
R6687:Lrrc14b UTSW 13 74360762 missense probably benign 0.00
R7309:Lrrc14b UTSW 13 74363202 missense probably benign 0.08
R7472:Lrrc14b UTSW 13 74363107 missense probably damaging 1.00
R7574:Lrrc14b UTSW 13 74360773 missense probably damaging 0.98
R7629:Lrrc14b UTSW 13 74361164 missense probably benign 0.03
R7695:Lrrc14b UTSW 13 74363178 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGGCTCTTAACTCTTGCTGG -3'
(R):5'- CCAGGCAACCTTAGAAAGTTGG -3'

Sequencing Primer
(F):5'- TCCCAGAGAACATTGTGTAAACAG -3'
(R):5'- TTGGAGGTAGTACACAATGTCC -3'
Posted On2020-07-13