Incidental Mutation 'R8169:Olfr741'
ID633993
Institutional Source Beutler Lab
Gene Symbol Olfr741
Ensembl Gene ENSMUSG00000095765
Gene Nameolfactory receptor 741
SynonymsMOR106-15, MOR106-10, GA_x6K02T2PMLR-6197851-6198786
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R8169 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50472738-50488338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50486235 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 259 (V259A)
Ref Sequence ENSEMBL: ENSMUSP00000145848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071932] [ENSMUST00000205518]
Predicted Effect probably benign
Transcript: ENSMUST00000071932
AA Change: V259A

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000071824
Gene: ENSMUSG00000095765
AA Change: V259A

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.2e-55 PFAM
Pfam:7tm_1 45 294 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205518
AA Change: V259A

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik C A 5: 139,364,057 G79V probably damaging Het
4930562C15Rik T A 16: 4,866,218 Y226N probably benign Het
6430573F11Rik A T 8: 36,511,703 K153N probably damaging Het
Bach1 G A 16: 87,722,502 C560Y possibly damaging Het
BC049730 T A 7: 24,712,575 M60K probably benign Het
Capn13 T A 17: 73,326,472 probably null Het
Casq2 G T 3: 102,110,312 A103S possibly damaging Het
Cfap100 A G 6: 90,417,674 F57S Het
Clca2 A T 3: 145,077,892 L654Q probably damaging Het
Cntnap5c T A 17: 58,104,770 probably null Het
Crtc2 G C 3: 90,263,576 G652A probably damaging Het
Csnk1g2 A G 10: 80,639,802 D401G probably damaging Het
Dars T C 1: 128,376,265 N242D probably null Het
Dnah10 T C 5: 124,800,882 L2677P probably damaging Het
Dnal1 G A 12: 84,124,556 A3T probably benign Het
Dpep2 C T 8: 105,996,217 V60I Het
Ehmt2 T A 17: 34,903,363 I302N probably benign Het
Eif3a C T 19: 60,762,190 R1309Q unknown Het
Eno4 T A 19: 58,946,652 Y100N probably benign Het
Ephx2 A T 14: 66,112,153 probably null Het
Fam102a T C 2: 32,563,748 I203T probably benign Het
Fbxw14 A T 9: 109,277,216 I251K probably benign Het
Fcgbp T C 7: 28,085,494 probably null Het
Foxm1 A C 6: 128,371,708 probably null Het
Fscn3 T A 6: 28,430,329 I166N possibly damaging Het
Gdpd4 G T 7: 97,972,128 V193L probably benign Het
Gm9573 T C 17: 35,621,180 T705A unknown Het
Gnpat T G 8: 124,880,130 C352G probably benign Het
H2-Q7 T A 17: 35,439,934 Y120* probably null Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Klri1 G A 6: 129,717,107 R6C probably benign Het
Kmo T C 1: 175,649,163 V154A probably benign Het
Kmt2c A G 5: 25,354,687 L1031P probably damaging Het
Lrrc14b T G 13: 74,363,167 T265P possibly damaging Het
Lrrc2 C T 9: 110,980,886 T330I probably benign Het
Lyn T A 4: 3,783,050 S428T probably damaging Het
Mfsd8 T A 3: 40,837,115 M59L probably benign Het
Mok T A 12: 110,808,365 Q341L probably benign Het
Myh3 C A 11: 67,089,030 N598K probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp4e A G 7: 23,320,506 I139M probably benign Het
Olfr139 T A 11: 74,044,881 Q131L possibly damaging Het
Olfr142 G A 2: 90,252,098 R297* probably null Het
Olfr577 A G 7: 102,973,338 L218P probably damaging Het
Olfr667 A T 7: 104,916,412 Y295N possibly damaging Het
Osbpl7 G A 11: 97,054,850 S312N probably damaging Het
Paxip1 A G 5: 27,772,095 L323P unknown Het
Pcdh18 T A 3: 49,745,235 H926L probably damaging Het
Pcm1 T G 8: 41,310,116 S1460R possibly damaging Het
Pdha2 A G 3: 141,211,394 S118P possibly damaging Het
Pdss1 A T 2: 22,901,812 Y86F probably benign Het
Ppargc1a A T 5: 51,473,684 D534E probably benign Het
Prune2 A G 19: 17,125,091 K2538R probably benign Het
Ptprq A T 10: 107,582,490 I1675N probably damaging Het
Rgma C T 7: 73,375,882 P3L probably benign Het
Ros1 A G 10: 52,064,672 probably null Het
Rsg1 A G 4: 141,218,219 H127R probably damaging Het
Sema4g C T 19: 44,998,971 R519W probably damaging Het
Serpinc1 T A 1: 160,993,401 F139L probably damaging Het
Slc22a29 A G 19: 8,207,332 I198T probably damaging Het
Slc4a5 T C 6: 83,303,391 V1007A probably benign Het
Sptbn1 T C 11: 30,197,783 Y17C possibly damaging Het
Tex261 C A 6: 83,775,017 probably null Het
Timmdc1 T A 16: 38,510,786 T128S probably benign Het
Tmem120b C A 5: 123,099,936 Y96* probably null Het
Tmem196 T A 12: 120,018,576 F182I possibly damaging Het
Tnxb G A 17: 34,699,207 V2365M possibly damaging Het
Tph1 T C 7: 46,653,809 silent Het
Trpc1 G A 9: 95,710,270 Q551* probably null Het
Tubgcp3 T C 8: 12,616,099 N828D probably benign Het
Unc13a C A 8: 71,656,289 G478W probably damaging Het
Usp15 T A 10: 123,125,893 T627S Het
Vmn1r115 A T 7: 20,844,219 I256N probably damaging Het
Vmn2r6 T A 3: 64,539,889 K585N probably benign Het
Vsir G T 10: 60,358,268 probably null Het
Xirp2 A G 2: 67,513,199 D1928G probably benign Het
Xylt1 A G 7: 117,650,619 Y672C probably damaging Het
Yrdc A G 4: 124,851,087 S105G probably benign Het
Zfc3h1 T A 10: 115,418,711 N1403K probably damaging Het
Zfp160 A T 17: 21,027,036 H616L probably damaging Het
Zfp637 T A 6: 117,845,291 F127I probably damaging Het
Zfp69 G T 4: 120,930,534 A528D probably damaging Het
Zpr1 T A 9: 46,278,347 L342Q possibly damaging Het
Other mutations in Olfr741
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Olfr741 APN 14 50485773 missense probably damaging 0.98
IGL01796:Olfr741 APN 14 50485541 missense probably benign 0.28
IGL01916:Olfr741 APN 14 50485493 missense probably benign 0.01
IGL02686:Olfr741 APN 14 50485969 missense probably benign 0.01
IGL02874:Olfr741 APN 14 50486229 missense possibly damaging 0.57
IGL02898:Olfr741 APN 14 50486186 missense probably damaging 1.00
PIT4515001:Olfr741 UTSW 14 50486079 missense probably benign 0.03
R0085:Olfr741 UTSW 14 50486334 missense probably benign 0.16
R1777:Olfr741 UTSW 14 50486300 missense probably benign 0.08
R1850:Olfr741 UTSW 14 50485598 missense probably benign
R2270:Olfr741 UTSW 14 50486037 missense probably damaging 1.00
R2338:Olfr741 UTSW 14 50485640 missense possibly damaging 0.47
R2971:Olfr741 UTSW 14 50485608 missense probably damaging 0.99
R4594:Olfr741 UTSW 14 50486162 missense probably benign 0.00
R5383:Olfr741 UTSW 14 50486052 nonsense probably null
R5708:Olfr741 UTSW 14 50485995 missense probably damaging 1.00
R6038:Olfr741 UTSW 14 50486220 missense probably damaging 1.00
R6038:Olfr741 UTSW 14 50486220 missense probably damaging 1.00
R7116:Olfr741 UTSW 14 50485568 missense probably benign 0.00
R7702:Olfr741 UTSW 14 50486294 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CCCATTGATAGAGGTTTTCTGGTC -3'
(R):5'- AGGGAGTACAGTATTTGACTTCC -3'

Sequencing Primer
(F):5'- GTCCATTATAATGTCTATGCTCCTGG -3'
(R):5'- GAGTACAGTATTTGACTTCCCATAAC -3'
Posted On2020-07-13