Incidental Mutation 'R8169:4930562C15Rik'
ID633994
Institutional Source Beutler Lab
Gene Symbol 4930562C15Rik
Ensembl Gene ENSMUSG00000022518
Gene NameRIKEN cDNA 4930562C15 gene
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_030192.1; MGI:1926059

Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R8169 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location4835416-4867686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4866218 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 226 (Y226N)
Ref Sequence ENSEMBL: ENSMUSP00000127814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100211] [ENSMUST00000171105] [ENSMUST00000176394] [ENSMUST00000176982]
Predicted Effect probably benign
Transcript: ENSMUST00000100211
AA Change: Y1065N

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097784
Gene: ENSMUSG00000022518
AA Change: Y1065N

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
coiled coil region 181 211 N/A INTRINSIC
internal_repeat_1 289 315 2.54e-5 PROSPERO
internal_repeat_1 314 341 2.54e-5 PROSPERO
low complexity region 360 377 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 452 469 N/A INTRINSIC
low complexity region 573 604 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 630 647 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
Pfam:DUF4795 745 960 1.7e-46 PFAM
low complexity region 1095 1109 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171105
AA Change: Y226N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127814
Gene: ENSMUSG00000022518
AA Change: Y226N

DomainStartEndE-ValueType
Pfam:DUF4795 37 125 1.1e-20 PFAM
low complexity region 256 270 N/A INTRINSIC
low complexity region 272 286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175762
Predicted Effect probably benign
Transcript: ENSMUST00000176394
Predicted Effect probably benign
Transcript: ENSMUST00000176982
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik C A 5: 139,364,057 G79V probably damaging Het
6430573F11Rik A T 8: 36,511,703 K153N probably damaging Het
Bach1 G A 16: 87,722,502 C560Y possibly damaging Het
BC049730 T A 7: 24,712,575 M60K probably benign Het
Capn13 T A 17: 73,326,472 probably null Het
Casq2 G T 3: 102,110,312 A103S possibly damaging Het
Cfap100 A G 6: 90,417,674 F57S Het
Clca2 A T 3: 145,077,892 L654Q probably damaging Het
Cntnap5c T A 17: 58,104,770 probably null Het
Crtc2 G C 3: 90,263,576 G652A probably damaging Het
Csnk1g2 A G 10: 80,639,802 D401G probably damaging Het
Dars T C 1: 128,376,265 N242D probably null Het
Dnah10 T C 5: 124,800,882 L2677P probably damaging Het
Dnal1 G A 12: 84,124,556 A3T probably benign Het
Dpep2 C T 8: 105,996,217 V60I Het
Ehmt2 T A 17: 34,903,363 I302N probably benign Het
Eif3a C T 19: 60,762,190 R1309Q unknown Het
Eno4 T A 19: 58,946,652 Y100N probably benign Het
Ephx2 A T 14: 66,112,153 probably null Het
Fam102a T C 2: 32,563,748 I203T probably benign Het
Fbxw14 A T 9: 109,277,216 I251K probably benign Het
Fcgbp T C 7: 28,085,494 probably null Het
Foxm1 A C 6: 128,371,708 probably null Het
Fscn3 T A 6: 28,430,329 I166N possibly damaging Het
Gdpd4 G T 7: 97,972,128 V193L probably benign Het
Gm9573 T C 17: 35,621,180 T705A unknown Het
Gnpat T G 8: 124,880,130 C352G probably benign Het
H2-Q7 T A 17: 35,439,934 Y120* probably null Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Klri1 G A 6: 129,717,107 R6C probably benign Het
Kmo T C 1: 175,649,163 V154A probably benign Het
Kmt2c A G 5: 25,354,687 L1031P probably damaging Het
Lrrc14b T G 13: 74,363,167 T265P possibly damaging Het
Lrrc2 C T 9: 110,980,886 T330I probably benign Het
Lyn T A 4: 3,783,050 S428T probably damaging Het
Mfsd8 T A 3: 40,837,115 M59L probably benign Het
Mok T A 12: 110,808,365 Q341L probably benign Het
Myh3 C A 11: 67,089,030 N598K probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp4e A G 7: 23,320,506 I139M probably benign Het
Olfr139 T A 11: 74,044,881 Q131L possibly damaging Het
Olfr142 G A 2: 90,252,098 R297* probably null Het
Olfr577 A G 7: 102,973,338 L218P probably damaging Het
Olfr667 A T 7: 104,916,412 Y295N possibly damaging Het
Olfr741 T C 14: 50,486,235 V259A probably benign Het
Osbpl7 G A 11: 97,054,850 S312N probably damaging Het
Paxip1 A G 5: 27,772,095 L323P unknown Het
Pcdh18 T A 3: 49,745,235 H926L probably damaging Het
Pcm1 T G 8: 41,310,116 S1460R possibly damaging Het
Pdha2 A G 3: 141,211,394 S118P possibly damaging Het
Pdss1 A T 2: 22,901,812 Y86F probably benign Het
Ppargc1a A T 5: 51,473,684 D534E probably benign Het
Prune2 A G 19: 17,125,091 K2538R probably benign Het
Ptprq A T 10: 107,582,490 I1675N probably damaging Het
Rgma C T 7: 73,375,882 P3L probably benign Het
Ros1 A G 10: 52,064,672 probably null Het
Rsg1 A G 4: 141,218,219 H127R probably damaging Het
Sema4g C T 19: 44,998,971 R519W probably damaging Het
Serpinc1 T A 1: 160,993,401 F139L probably damaging Het
Slc22a29 A G 19: 8,207,332 I198T probably damaging Het
Slc4a5 T C 6: 83,303,391 V1007A probably benign Het
Sptbn1 T C 11: 30,197,783 Y17C possibly damaging Het
Tex261 C A 6: 83,775,017 probably null Het
Timmdc1 T A 16: 38,510,786 T128S probably benign Het
Tmem120b C A 5: 123,099,936 Y96* probably null Het
Tmem196 T A 12: 120,018,576 F182I possibly damaging Het
Tnxb G A 17: 34,699,207 V2365M possibly damaging Het
Tph1 T C 7: 46,653,809 silent Het
Trpc1 G A 9: 95,710,270 Q551* probably null Het
Tubgcp3 T C 8: 12,616,099 N828D probably benign Het
Unc13a C A 8: 71,656,289 G478W probably damaging Het
Usp15 T A 10: 123,125,893 T627S Het
Vmn1r115 A T 7: 20,844,219 I256N probably damaging Het
Vmn2r6 T A 3: 64,539,889 K585N probably benign Het
Vsir G T 10: 60,358,268 probably null Het
Xirp2 A G 2: 67,513,199 D1928G probably benign Het
Xylt1 A G 7: 117,650,619 Y672C probably damaging Het
Yrdc A G 4: 124,851,087 S105G probably benign Het
Zfc3h1 T A 10: 115,418,711 N1403K probably damaging Het
Zfp160 A T 17: 21,027,036 H616L probably damaging Het
Zfp637 T A 6: 117,845,291 F127I probably damaging Het
Zfp69 G T 4: 120,930,534 A528D probably damaging Het
Zpr1 T A 9: 46,278,347 L342Q possibly damaging Het
Other mutations in 4930562C15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:4930562C15Rik APN 16 4864646 missense probably benign 0.31
IGL01610:4930562C15Rik APN 16 4851565 splice site probably benign
IGL02869:4930562C15Rik APN 16 4867459 missense possibly damaging 0.68
IGL03242:4930562C15Rik APN 16 4849325 missense unknown
R0063:4930562C15Rik UTSW 16 4861048 nonsense probably null
R0063:4930562C15Rik UTSW 16 4861048 nonsense probably null
R0083:4930562C15Rik UTSW 16 4849542 missense unknown
R0565:4930562C15Rik UTSW 16 4864336 missense probably benign 0.22
R0630:4930562C15Rik UTSW 16 4850939 missense possibly damaging 0.90
R0734:4930562C15Rik UTSW 16 4850334 missense probably benign 0.01
R1200:4930562C15Rik UTSW 16 4849672 missense unknown
R1738:4930562C15Rik UTSW 16 4864611 missense probably damaging 1.00
R1775:4930562C15Rik UTSW 16 4851558 splice site probably null
R1945:4930562C15Rik UTSW 16 4835685 missense unknown
R2132:4930562C15Rik UTSW 16 4835971 missense unknown
R2445:4930562C15Rik UTSW 16 4864397 splice site probably null
R2696:4930562C15Rik UTSW 16 4850364 missense probably benign 0.04
R4729:4930562C15Rik UTSW 16 4849323 missense unknown
R4779:4930562C15Rik UTSW 16 4849749 missense unknown
R4806:4930562C15Rik UTSW 16 4849672 missense unknown
R4808:4930562C15Rik UTSW 16 4849672 missense unknown
R4876:4930562C15Rik UTSW 16 4849672 missense unknown
R4931:4930562C15Rik UTSW 16 4861046 missense possibly damaging 0.47
R4956:4930562C15Rik UTSW 16 4854952 missense probably damaging 0.99
R5085:4930562C15Rik UTSW 16 4835973 nonsense probably null
R5203:4930562C15Rik UTSW 16 4835598 missense unknown
R5229:4930562C15Rik UTSW 16 4850051 missense possibly damaging 0.73
R5461:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5462:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5464:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5595:4930562C15Rik UTSW 16 4864279 missense probably benign 0.01
R6054:4930562C15Rik UTSW 16 4835865 missense unknown
R6405:4930562C15Rik UTSW 16 4851878 missense probably damaging 0.97
R6859:4930562C15Rik UTSW 16 4851935 missense possibly damaging 0.86
R7124:4930562C15Rik UTSW 16 4864332 missense probably benign 0.02
R7139:4930562C15Rik UTSW 16 4850184 missense probably benign 0.00
R7182:4930562C15Rik UTSW 16 4849714 missense unknown
R7219:4930562C15Rik UTSW 16 4849644 missense unknown
R7366:4930562C15Rik UTSW 16 4835769 missense unknown
R7592:4930562C15Rik UTSW 16 4849274 missense unknown
R7759:4930562C15Rik UTSW 16 4864650 missense probably benign 0.01
R7789:4930562C15Rik UTSW 16 4864311 missense probably benign 0.01
R7873:4930562C15Rik UTSW 16 4866227 missense probably benign
R7916:4930562C15Rik UTSW 16 4864590 nonsense probably null
R8093:4930562C15Rik UTSW 16 4851504 missense possibly damaging 0.86
R8278:4930562C15Rik UTSW 16 4850176 missense probably benign 0.33
R8372:4930562C15Rik UTSW 16 4864288 missense probably damaging 0.99
R8493:4930562C15Rik UTSW 16 4835589 start codon destroyed unknown
R8549:4930562C15Rik UTSW 16 4863197 critical splice donor site probably null
X0028:4930562C15Rik UTSW 16 4867367 missense possibly damaging 0.83
Z1176:4930562C15Rik UTSW 16 4866248 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GCAAGGGGCTTTTCTCTCAG -3'
(R):5'- ACTGGAGGCCCCATAACTTC -3'

Sequencing Primer
(F):5'- CTCAGTGGATGGTATATAAGAAACAG -3'
(R):5'- CAGCCAGCCAGAAGGTG -3'
Posted On2020-07-13