Incidental Mutation 'R8170:Capn10'
ID 634010
Institutional Source Beutler Lab
Gene Symbol Capn10
Ensembl Gene ENSMUSG00000026270
Gene Name calpain 10
Synonyms Capn8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock # R8170 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 92934376-92947941 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92934964 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 31 (S31P)
Ref Sequence ENSEMBL: ENSMUSP00000027488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027488] [ENSMUST00000117814] [ENSMUST00000152983]
AlphaFold Q9ESK3
Predicted Effect probably damaging
Transcript: ENSMUST00000027488
AA Change: S31P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027488
Gene: ENSMUSG00000026270
AA Change: S31P

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.05e-60 SMART
calpain_III 507 645 1.3e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117814
AA Change: S31P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112831
Gene: ENSMUSG00000026270
AA Change: S31P

DomainStartEndE-ValueType
CysPc 2 263 1.29e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152983
AA Change: S31P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122158
Gene: ENSMUSG00000026270
AA Change: S31P

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.71e-60 SMART
low complexity region 490 499 N/A INTRINSIC
Meta Mutation Damage Score 0.1644 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domain I, the N-terminal regulatory domain that is processed upon calpain activation; domain II, the protease domain; domain III, a linker domain of unknown function; and domain IV, the calmodulin-like calcium-binding domain. This gene encodes a large subunit. It is an atypical calpain in that it lacks the calmodulin-like calcium-binding domain and instead has a divergent C-terminal domain. It is similar in organization to calpains 5 and 6. This gene is associated with type 2 or non-insulin-dependent diabetes mellitus (NIDDM), and is located within the NIDDM1 region. Multiple alternative transcript variants have been described for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to ryanodine- and palmitate-induced pancreatic apoptosis. Mice homozygous for a different knock-out allele exhibit increased adiposity, body and organ weights, and leptin serum levels on background containing LG/J. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,263,594 V595A probably benign Het
A430033K04Rik A G 5: 138,647,053 E400G possibly damaging Het
Abca16 C T 7: 120,465,782 T554I probably damaging Het
Acadm T A 3: 153,944,398 R10W possibly damaging Het
Arhgef25 A G 10: 127,187,179 W120R probably damaging Het
Atg7 A T 6: 114,701,190 Q347L probably benign Het
Atl2 T C 17: 79,856,261 I316V possibly damaging Het
B4galnt3 A T 6: 120,206,616 probably null Het
Baiap2l1 A T 5: 144,277,692 Y397* probably null Het
Cacna1b A G 2: 24,678,874 probably null Het
Casp8ap2 C T 4: 32,615,490 probably benign Het
Ccdc122 A T 14: 77,091,878 I124L probably benign Het
Ccdc90b A G 7: 92,561,542 S3G probably benign Het
Cdc14b A T 13: 64,215,735 probably null Het
Chd5 T A 4: 152,376,583 M1210K probably benign Het
Clec18a T G 8: 111,080,919 K133T probably damaging Het
Cog4 T A 8: 110,866,031 M413K probably damaging Het
Cpa5 A T 6: 30,624,595 I145L probably benign Het
Ctdspl2 T G 2: 122,006,942 S397A probably benign Het
Dnah8 T A 17: 30,673,823 I794N probably damaging Het
Ednrb T A 14: 103,823,204 T218S possibly damaging Het
Eif3b T A 5: 140,426,775 probably null Het
Fam208b G A 13: 3,574,881 Q1690* probably null Het
Fanci A C 7: 79,433,557 probably null Het
Fat2 C T 11: 55,270,455 V3150M probably damaging Het
Fat3 T C 9: 15,947,496 Y3808C probably damaging Het
Gabrr1 T A 4: 33,162,718 L428Q probably damaging Het
Garnl3 G C 2: 33,015,223 P488R possibly damaging Het
Gli3 T C 13: 15,720,208 S656P probably benign Het
Gm35339 C A 15: 76,363,619 F1614L Het
Gpr153 T C 4: 152,280,177 I230T probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hoxc6 A G 15: 103,009,861 N86D probably benign Het
Iqch T G 9: 63,429,030 R985S probably damaging Het
Jun T A 4: 95,050,322 N317I probably damaging Het
Kif26a T G 12: 112,175,318 probably null Het
Map4k3 T C 17: 80,605,860 H627R possibly damaging Het
Misp T A 10: 79,826,466 I239N probably benign Het
Mpzl2 T A 9: 45,043,721 V27E probably damaging Het
Mta3 T C 17: 83,791,661 S385P probably damaging Het
Muc5b G A 7: 141,861,000 S2561N unknown Het
Myh8 A G 11: 67,288,266 H495R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp5 A T 7: 23,433,710 T927S probably benign Het
Nr5a2 T A 1: 136,940,647 D310V probably benign Het
Nrbp1 A G 5: 31,245,803 T207A probably damaging Het
Nxf1 G T 19: 8,771,050 L14F probably benign Het
Olfr447 G A 6: 42,912,191 A223T possibly damaging Het
Olfr777 T A 10: 129,269,048 N92Y possibly damaging Het
Pcdhb15 A G 18: 37,475,584 E623G probably damaging Het
Pid1 T C 1: 84,285,000 probably null Het
Plcb2 C A 2: 118,711,453 R892L possibly damaging Het
Polr1a C G 6: 71,920,749 P243A probably benign Het
Pot1a A G 6: 25,758,803 *326Q probably null Het
Ppp5c G T 7: 17,007,146 F335L probably damaging Het
Prl8a2 T C 13: 27,352,811 Y139H probably benign Het
Rogdi G T 16: 5,011,737 R93S probably benign Het
Rsph6a C A 7: 19,057,580 R225S probably damaging Het
Sept8 T C 11: 53,537,857 S408P possibly damaging Het
Sf3a2 T A 10: 80,803,297 probably null Het
Shank3 T C 15: 89,548,840 S1263P possibly damaging Het
Speer4f2 A C 5: 17,374,461 D86A Het
Stard9 T C 2: 120,700,048 F2262S possibly damaging Het
Svep1 T A 4: 58,069,378 I2803F probably benign Het
Taf1c C T 8: 119,602,826 probably null Het
Tepp A T 8: 95,320,058 I120F probably damaging Het
Tfap2a C T 13: 40,719,268 V317I probably benign Het
Thnsl2 T C 6: 71,129,333 T370A probably benign Het
Tmem201 C T 4: 149,718,720 G564S probably benign Het
Ttc41 A C 10: 86,776,166 E1101A probably damaging Het
Ugcg T A 4: 59,211,974 F113L possibly damaging Het
Unc80 G T 1: 66,651,533 V2456L probably benign Het
Vav3 A T 3: 109,424,007 N74I probably damaging Het
Vmn2r25 T A 6: 123,853,017 R58S probably benign Het
Ylpm1 T A 12: 85,034,027 M1499K probably benign Het
Zfp647 A G 15: 76,911,371 V363A possibly damaging Het
Other mutations in Capn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Capn10 APN 1 92942559 missense probably benign 0.00
IGL01071:Capn10 APN 1 92945075 missense probably damaging 1.00
IGL01682:Capn10 APN 1 92940384 missense probably benign 0.16
IGL01771:Capn10 APN 1 92940365 missense probably damaging 1.00
IGL02952:Capn10 APN 1 92945174 missense probably damaging 0.97
IGL03177:Capn10 APN 1 92934982 missense probably benign 0.02
IGL03224:Capn10 APN 1 92939324 missense probably damaging 1.00
P4717OSA:Capn10 UTSW 1 92939394 missense probably damaging 1.00
R1256:Capn10 UTSW 1 92946946 missense probably damaging 1.00
R1405:Capn10 UTSW 1 92945022 missense probably benign 0.34
R1405:Capn10 UTSW 1 92945022 missense probably benign 0.34
R1653:Capn10 UTSW 1 92946898 missense probably damaging 1.00
R1737:Capn10 UTSW 1 92934955 missense probably benign 0.10
R2127:Capn10 UTSW 1 92938034 nonsense probably null
R2433:Capn10 UTSW 1 92942525 missense probably benign 0.22
R2484:Capn10 UTSW 1 92944843 missense probably damaging 0.97
R4004:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4005:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4560:Capn10 UTSW 1 92939362 missense probably damaging 1.00
R4684:Capn10 UTSW 1 92943781 missense probably damaging 1.00
R4766:Capn10 UTSW 1 92943419 missense probably damaging 0.98
R4996:Capn10 UTSW 1 92945136 missense probably damaging 1.00
R5665:Capn10 UTSW 1 92937931 splice site probably null
R5733:Capn10 UTSW 1 92943913 missense probably benign 0.03
R5937:Capn10 UTSW 1 92939383 missense probably damaging 1.00
R6985:Capn10 UTSW 1 92943424 missense probably damaging 1.00
R7140:Capn10 UTSW 1 92945271 missense possibly damaging 0.85
R7495:Capn10 UTSW 1 92943370 missense probably damaging 1.00
R8393:Capn10 UTSW 1 92943408 missense probably benign 0.09
R8943:Capn10 UTSW 1 92943732 missense probably damaging 1.00
R9303:Capn10 UTSW 1 92943943 critical splice donor site probably null
R9305:Capn10 UTSW 1 92943943 critical splice donor site probably null
R9655:Capn10 UTSW 1 92939389 missense probably damaging 1.00
R9776:Capn10 UTSW 1 92943864 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GGTTACCTAGACAACGGAGCTTG -3'
(R):5'- AGGGCTGGCTATCACCTTTTC -3'

Sequencing Primer
(F):5'- TAGGCTGCTCTGCACCAGTAG -3'
(R):5'- CACCTTTTCTGAATAGGCTTGAAGGC -3'
Posted On 2020-07-13