Incidental Mutation 'R8170:Garnl3'
ID634013
Institutional Source Beutler Lab
Gene Symbol Garnl3
Ensembl Gene ENSMUSG00000038860
Gene NameGTPase activating RANGAP domain-like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R8170 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32986224-33131654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 33015223 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 488 (P488R)
Ref Sequence ENSEMBL: ENSMUSP00000122576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000137381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049618
AA Change: P447R

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: P447R

DomainStartEndE-ValueType
Pfam:Rap_GAP 202 383 3.4e-73 PFAM
Pfam:CNH 475 780 3.5e-67 PFAM
low complexity region 793 804 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102810
AA Change: P443R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: P443R

DomainStartEndE-ValueType
Pfam:Rap_GAP 198 385 4.6e-67 PFAM
Pfam:CNH 471 776 1.8e-68 PFAM
low complexity region 789 800 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000137381
AA Change: P488R

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000193171
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,263,594 V595A probably benign Het
A430033K04Rik A G 5: 138,647,053 E400G possibly damaging Het
Abca16 C T 7: 120,465,782 T554I probably damaging Het
Acadm T A 3: 153,944,398 R10W possibly damaging Het
Arhgef25 A G 10: 127,187,179 W120R probably damaging Het
Atg7 A T 6: 114,701,190 Q347L probably benign Het
Atl2 T C 17: 79,856,261 I316V possibly damaging Het
B4galnt3 A T 6: 120,206,616 probably null Het
Baiap2l1 A T 5: 144,277,692 Y397* probably null Het
Cacna1b A G 2: 24,678,874 probably null Het
Capn10 T C 1: 92,934,964 S31P probably damaging Het
Casp8ap2 C T 4: 32,615,490 probably benign Het
Ccdc122 A T 14: 77,091,878 I124L probably benign Het
Ccdc90b A G 7: 92,561,542 S3G probably benign Het
Cdc14b A T 13: 64,215,735 probably null Het
Chd5 T A 4: 152,376,583 M1210K probably benign Het
Clec18a T G 8: 111,080,919 K133T probably damaging Het
Cog4 T A 8: 110,866,031 M413K probably damaging Het
Cpa5 A T 6: 30,624,595 I145L probably benign Het
Ctdspl2 T G 2: 122,006,942 S397A probably benign Het
Dnah8 T A 17: 30,673,823 I794N probably damaging Het
Ednrb T A 14: 103,823,204 T218S possibly damaging Het
Eif3b T A 5: 140,426,775 probably null Het
Fam208b G A 13: 3,574,881 Q1690* probably null Het
Fanci A C 7: 79,433,557 probably null Het
Fat2 C T 11: 55,270,455 V3150M probably damaging Het
Fat3 T C 9: 15,947,496 Y3808C probably damaging Het
Gabrr1 T A 4: 33,162,718 L428Q probably damaging Het
Gli3 T C 13: 15,720,208 S656P probably benign Het
Gm35339 C A 15: 76,363,619 F1614L Het
Gpr153 T C 4: 152,280,177 I230T probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hoxc6 A G 15: 103,009,861 N86D probably benign Het
Iqch T G 9: 63,429,030 R985S probably damaging Het
Jun T A 4: 95,050,322 N317I probably damaging Het
Kif26a T G 12: 112,175,318 probably null Het
Map4k3 T C 17: 80,605,860 H627R possibly damaging Het
Misp T A 10: 79,826,466 I239N probably benign Het
Mpzl2 T A 9: 45,043,721 V27E probably damaging Het
Mta3 T C 17: 83,791,661 S385P probably damaging Het
Muc5b G A 7: 141,861,000 S2561N unknown Het
Myh8 A G 11: 67,288,266 H495R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp5 A T 7: 23,433,710 T927S probably benign Het
Nr5a2 T A 1: 136,940,647 D310V probably benign Het
Nrbp1 A G 5: 31,245,803 T207A probably damaging Het
Nxf1 G T 19: 8,771,050 L14F probably benign Het
Olfr447 G A 6: 42,912,191 A223T possibly damaging Het
Olfr777 T A 10: 129,269,048 N92Y possibly damaging Het
Pcdhb15 A G 18: 37,475,584 E623G probably damaging Het
Pid1 T C 1: 84,285,000 probably null Het
Plcb2 C A 2: 118,711,453 R892L possibly damaging Het
Polr1a C G 6: 71,920,749 P243A probably benign Het
Pot1a A G 6: 25,758,803 *326Q probably null Het
Ppp5c G T 7: 17,007,146 F335L probably damaging Het
Prl8a2 T C 13: 27,352,811 Y139H probably benign Het
Rogdi G T 16: 5,011,737 R93S probably benign Het
Rsph6a C A 7: 19,057,580 R225S probably damaging Het
Sept8 T C 11: 53,537,857 S408P possibly damaging Het
Sf3a2 T A 10: 80,803,297 probably null Het
Shank3 T C 15: 89,548,840 S1263P possibly damaging Het
Speer4f2 A C 5: 17,374,461 D86A Het
Stard9 T C 2: 120,700,048 F2262S possibly damaging Het
Svep1 T A 4: 58,069,378 I2803F probably benign Het
Taf1c C T 8: 119,602,826 probably null Het
Tepp A T 8: 95,320,058 I120F probably damaging Het
Tfap2a C T 13: 40,719,268 V317I probably benign Het
Thnsl2 T C 6: 71,129,333 T370A probably benign Het
Tmem201 C T 4: 149,718,720 G564S probably benign Het
Ttc41 A C 10: 86,776,166 E1101A probably damaging Het
Ugcg T A 4: 59,211,974 F113L possibly damaging Het
Unc80 G T 1: 66,651,533 V2456L probably benign Het
Vav3 A T 3: 109,424,007 N74I probably damaging Het
Vmn2r25 T A 6: 123,853,017 R58S probably benign Het
Ylpm1 T A 12: 85,034,027 M1499K probably benign Het
Zfp647 A G 15: 76,911,371 V363A possibly damaging Het
Other mutations in Garnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Garnl3 APN 2 33006816 missense probably damaging 1.00
IGL01601:Garnl3 APN 2 32997689 nonsense probably null
IGL01981:Garnl3 APN 2 32997729 missense probably damaging 0.98
IGL02209:Garnl3 APN 2 33085930 missense probably damaging 0.99
IGL02434:Garnl3 APN 2 33054205 missense probably damaging 1.00
IGL02512:Garnl3 APN 2 33031138 missense probably damaging 1.00
IGL02947:Garnl3 APN 2 33046594 missense probably damaging 1.00
PIT4403001:Garnl3 UTSW 2 32990758 missense probably damaging 1.00
R0123:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0134:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0225:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0551:Garnl3 UTSW 2 33016738 missense probably damaging 1.00
R0691:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0693:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0737:Garnl3 UTSW 2 32990642 missense probably damaging 0.98
R1350:Garnl3 UTSW 2 33052214 missense probably damaging 1.00
R1691:Garnl3 UTSW 2 32997663 nonsense probably null
R1791:Garnl3 UTSW 2 33034127 missense probably benign 0.02
R1938:Garnl3 UTSW 2 33005200 missense probably damaging 0.99
R2100:Garnl3 UTSW 2 33046645 missense probably benign 0.35
R2316:Garnl3 UTSW 2 33005152 missense probably damaging 1.00
R2353:Garnl3 UTSW 2 33064034 missense probably damaging 1.00
R3161:Garnl3 UTSW 2 33034711 missense probably damaging 1.00
R3839:Garnl3 UTSW 2 32989546 missense probably benign 0.00
R3847:Garnl3 UTSW 2 32992228 missense probably benign
R4871:Garnl3 UTSW 2 33087088 start codon destroyed probably null 0.77
R5682:Garnl3 UTSW 2 33054173 missense probably damaging 1.00
R5811:Garnl3 UTSW 2 33006899 missense probably damaging 0.99
R6267:Garnl3 UTSW 2 33104880 missense probably benign 0.20
R6502:Garnl3 UTSW 2 33006821 missense possibly damaging 0.67
R6532:Garnl3 UTSW 2 33031119 missense possibly damaging 0.87
R6639:Garnl3 UTSW 2 32989525 missense possibly damaging 0.75
R6763:Garnl3 UTSW 2 33054196 missense probably damaging 1.00
R6866:Garnl3 UTSW 2 33002773 splice site probably null
R6913:Garnl3 UTSW 2 32986829 missense possibly damaging 0.91
R7002:Garnl3 UTSW 2 33054193 missense possibly damaging 0.65
R7168:Garnl3 UTSW 2 32995078 missense probably damaging 1.00
R7341:Garnl3 UTSW 2 33034129 missense probably damaging 1.00
R7746:Garnl3 UTSW 2 32992257 missense probably damaging 1.00
R7919:Garnl3 UTSW 2 33046599 missense probably benign 0.38
R8079:Garnl3 UTSW 2 33018499 critical splice donor site probably null
R8087:Garnl3 UTSW 2 33045536 missense probably benign 0.01
R8123:Garnl3 UTSW 2 33104938 missense probably damaging 0.97
R8347:Garnl3 UTSW 2 33085891 missense probably damaging 1.00
R8418:Garnl3 UTSW 2 33052146 missense possibly damaging 0.73
R8679:Garnl3 UTSW 2 33026094 missense probably damaging 1.00
R8940:Garnl3 UTSW 2 33005229 critical splice acceptor site probably null
X0022:Garnl3 UTSW 2 33022668 missense probably damaging 1.00
X0023:Garnl3 UTSW 2 33026149 missense probably damaging 1.00
X0024:Garnl3 UTSW 2 33005179 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACTGCTTGCCATCTGTGCG -3'
(R):5'- CCAGAAACAGTAGGTGTATTTTGGG -3'

Sequencing Primer
(F):5'- CACAGATGACATTCCCAG -3'
(R):5'- ATAGCCCTATGACTTGGGGC -3'
Posted On2020-07-13