Incidental Mutation 'R8170:Plcb2'
ID634014
Institutional Source Beutler Lab
Gene Symbol Plcb2
Ensembl Gene ENSMUSG00000040061
Gene Namephospholipase C, beta 2
SynonymsB230205M18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8170 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location118707517-118728438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 118711453 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 892 (R892L)
Ref Sequence ENSEMBL: ENSMUSP00000124364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102524] [ENSMUST00000159756]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102524
AA Change: R915L

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061
AA Change: R915L

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 220 311 2.5e-24 PFAM
PLCXc 312 463 2.87e-79 SMART
low complexity region 504 518 N/A INTRINSIC
PLCYc 547 663 2.39e-67 SMART
C2 684 783 9.17e-15 SMART
low complexity region 902 925 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
Pfam:PLC-beta_C 974 1149 4.7e-72 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159756
AA Change: R892L

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124364
Gene: ENSMUSG00000040061
AA Change: R892L

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 197 288 7.1e-26 PFAM
PLCXc 289 440 2.87e-79 SMART
low complexity region 481 495 N/A INTRINSIC
PLCYc 524 640 2.39e-67 SMART
C2 661 760 9.17e-15 SMART
low complexity region 879 902 N/A INTRINSIC
low complexity region 906 917 N/A INTRINSIC
Pfam:PLC-beta_C 946 1129 5.1e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant mice showed an increased sensitivity to both bacterial and viral infections and exhibited abnormal taste perception in which sweet, umami, and bitter stimuli could not be sensed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,263,594 V595A probably benign Het
A430033K04Rik A G 5: 138,647,053 E400G possibly damaging Het
Abca16 C T 7: 120,465,782 T554I probably damaging Het
Acadm T A 3: 153,944,398 R10W possibly damaging Het
Arhgef25 A G 10: 127,187,179 W120R probably damaging Het
Atg7 A T 6: 114,701,190 Q347L probably benign Het
Atl2 T C 17: 79,856,261 I316V possibly damaging Het
B4galnt3 A T 6: 120,206,616 probably null Het
Baiap2l1 A T 5: 144,277,692 Y397* probably null Het
Cacna1b A G 2: 24,678,874 probably null Het
Capn10 T C 1: 92,934,964 S31P probably damaging Het
Casp8ap2 C T 4: 32,615,490 probably benign Het
Ccdc122 A T 14: 77,091,878 I124L probably benign Het
Ccdc90b A G 7: 92,561,542 S3G probably benign Het
Cdc14b A T 13: 64,215,735 probably null Het
Chd5 T A 4: 152,376,583 M1210K probably benign Het
Clec18a T G 8: 111,080,919 K133T probably damaging Het
Cog4 T A 8: 110,866,031 M413K probably damaging Het
Cpa5 A T 6: 30,624,595 I145L probably benign Het
Ctdspl2 T G 2: 122,006,942 S397A probably benign Het
Dnah8 T A 17: 30,673,823 I794N probably damaging Het
Ednrb T A 14: 103,823,204 T218S possibly damaging Het
Eif3b T A 5: 140,426,775 probably null Het
Fam208b G A 13: 3,574,881 Q1690* probably null Het
Fanci A C 7: 79,433,557 probably null Het
Fat2 C T 11: 55,270,455 V3150M probably damaging Het
Fat3 T C 9: 15,947,496 Y3808C probably damaging Het
Gabrr1 T A 4: 33,162,718 L428Q probably damaging Het
Garnl3 G C 2: 33,015,223 P488R possibly damaging Het
Gli3 T C 13: 15,720,208 S656P probably benign Het
Gm35339 C A 15: 76,363,619 F1614L Het
Gpr153 T C 4: 152,280,177 I230T probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hoxc6 A G 15: 103,009,861 N86D probably benign Het
Iqch T G 9: 63,429,030 R985S probably damaging Het
Jun T A 4: 95,050,322 N317I probably damaging Het
Kif26a T G 12: 112,175,318 probably null Het
Map4k3 T C 17: 80,605,860 H627R possibly damaging Het
Misp T A 10: 79,826,466 I239N probably benign Het
Mpzl2 T A 9: 45,043,721 V27E probably damaging Het
Mta3 T C 17: 83,791,661 S385P probably damaging Het
Muc5b G A 7: 141,861,000 S2561N unknown Het
Myh8 A G 11: 67,288,266 H495R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp5 A T 7: 23,433,710 T927S probably benign Het
Nr5a2 T A 1: 136,940,647 D310V probably benign Het
Nrbp1 A G 5: 31,245,803 T207A probably damaging Het
Nxf1 G T 19: 8,771,050 L14F probably benign Het
Olfr447 G A 6: 42,912,191 A223T possibly damaging Het
Olfr777 T A 10: 129,269,048 N92Y possibly damaging Het
Pcdhb15 A G 18: 37,475,584 E623G probably damaging Het
Pid1 T C 1: 84,285,000 probably null Het
Polr1a C G 6: 71,920,749 P243A probably benign Het
Pot1a A G 6: 25,758,803 *326Q probably null Het
Ppp5c G T 7: 17,007,146 F335L probably damaging Het
Prl8a2 T C 13: 27,352,811 Y139H probably benign Het
Rogdi G T 16: 5,011,737 R93S probably benign Het
Rsph6a C A 7: 19,057,580 R225S probably damaging Het
Sept8 T C 11: 53,537,857 S408P possibly damaging Het
Sf3a2 T A 10: 80,803,297 probably null Het
Shank3 T C 15: 89,548,840 S1263P possibly damaging Het
Speer4f2 A C 5: 17,374,461 D86A Het
Stard9 T C 2: 120,700,048 F2262S possibly damaging Het
Svep1 T A 4: 58,069,378 I2803F probably benign Het
Taf1c C T 8: 119,602,826 probably null Het
Tepp A T 8: 95,320,058 I120F probably damaging Het
Tfap2a C T 13: 40,719,268 V317I probably benign Het
Thnsl2 T C 6: 71,129,333 T370A probably benign Het
Tmem201 C T 4: 149,718,720 G564S probably benign Het
Ttc41 A C 10: 86,776,166 E1101A probably damaging Het
Ugcg T A 4: 59,211,974 F113L possibly damaging Het
Unc80 G T 1: 66,651,533 V2456L probably benign Het
Vav3 A T 3: 109,424,007 N74I probably damaging Het
Vmn2r25 T A 6: 123,853,017 R58S probably benign Het
Ylpm1 T A 12: 85,034,027 M1499K probably benign Het
Zfp647 A G 15: 76,911,371 V363A possibly damaging Het
Other mutations in Plcb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Plcb2 APN 2 118718889 missense probably damaging 1.00
IGL00715:Plcb2 APN 2 118713734 critical splice donor site probably null
IGL00851:Plcb2 APN 2 118728251 missense probably benign 0.30
IGL01765:Plcb2 APN 2 118710268 splice site probably benign
IGL01837:Plcb2 APN 2 118711926 splice site probably null
IGL01868:Plcb2 APN 2 118709590 missense probably damaging 1.00
IGL01868:Plcb2 APN 2 118711387 missense probably benign 0.09
IGL02158:Plcb2 APN 2 118711363 missense probably benign 0.06
IGL02447:Plcb2 APN 2 118713155 missense probably damaging 1.00
IGL02490:Plcb2 APN 2 118719760 missense probably damaging 0.99
IGL02691:Plcb2 APN 2 118710963 missense probably benign 0.00
IGL02723:Plcb2 APN 2 118717019 splice site probably benign
IGL02929:Plcb2 APN 2 118713234 splice site probably benign
IGL02949:Plcb2 APN 2 118719109 splice site probably null
PIT4480001:Plcb2 UTSW 2 118723496 missense probably benign 0.00
R0031:Plcb2 UTSW 2 118715461 missense probably benign 0.36
R0157:Plcb2 UTSW 2 118718541 missense probably damaging 0.98
R0366:Plcb2 UTSW 2 118724447 missense probably benign 0.01
R0376:Plcb2 UTSW 2 118717240 missense probably damaging 0.99
R0570:Plcb2 UTSW 2 118717325 missense probably benign 0.32
R0790:Plcb2 UTSW 2 118712483 splice site probably benign
R0893:Plcb2 UTSW 2 118725105 splice site probably benign
R1647:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1648:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1686:Plcb2 UTSW 2 118715687 splice site probably benign
R2210:Plcb2 UTSW 2 118717503 missense probably damaging 1.00
R2211:Plcb2 UTSW 2 118723534 missense probably benign 0.05
R2251:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2252:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2253:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2426:Plcb2 UTSW 2 118715649 missense probably damaging 1.00
R3970:Plcb2 UTSW 2 118715690 splice site probably benign
R4007:Plcb2 UTSW 2 118710793 missense probably damaging 1.00
R4162:Plcb2 UTSW 2 118709587 missense probably damaging 1.00
R4236:Plcb2 UTSW 2 118709566 missense probably damaging 1.00
R4422:Plcb2 UTSW 2 118712003 missense probably benign 0.28
R4772:Plcb2 UTSW 2 118713134 missense probably benign 0.20
R4795:Plcb2 UTSW 2 118711124 missense probably benign 0.32
R4935:Plcb2 UTSW 2 118718915 missense probably damaging 1.00
R5019:Plcb2 UTSW 2 118712136 missense probably benign 0.01
R5055:Plcb2 UTSW 2 118718222 missense probably benign 0.06
R5452:Plcb2 UTSW 2 118718246 missense probably damaging 0.98
R5622:Plcb2 UTSW 2 118714729 missense probably damaging 1.00
R5752:Plcb2 UTSW 2 118711051 intron probably benign
R6284:Plcb2 UTSW 2 118717301 missense probably benign 0.37
R6380:Plcb2 UTSW 2 118715468 missense probably damaging 1.00
R6574:Plcb2 UTSW 2 118719173 missense probably damaging 0.99
R6728:Plcb2 UTSW 2 118723690 missense probably damaging 1.00
R6792:Plcb2 UTSW 2 118719441 missense probably damaging 1.00
R7529:Plcb2 UTSW 2 118710234 missense probably damaging 1.00
R7560:Plcb2 UTSW 2 118715643 missense probably damaging 0.99
R7610:Plcb2 UTSW 2 118719759 missense possibly damaging 0.86
R7760:Plcb2 UTSW 2 118711388 missense probably benign
R8152:Plcb2 UTSW 2 118710821 missense probably benign 0.22
X0024:Plcb2 UTSW 2 118712375 missense probably benign 0.13
Z1176:Plcb2 UTSW 2 118723128 missense probably damaging 0.99
Z1177:Plcb2 UTSW 2 118709200 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGGCGATTTGCTGCGAAG -3'
(R):5'- AACTGAGGTGCCTCCAAAGC -3'

Sequencing Primer
(F):5'- CCTTGGCTGTGCAGAAAGG -3'
(R):5'- ACCTGACAGTCCAGCTCTGTG -3'
Posted On2020-07-13