Incidental Mutation 'R8170:Gpr153'
ID 634024
Institutional Source Beutler Lab
Gene Symbol Gpr153
Ensembl Gene ENSMUSG00000042804
Gene Name G protein-coupled receptor 153
Synonyms PGR1, 1110065N12Rik
MMRRC Submission 067596-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8170 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 152358689-152369794 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 152364634 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 230 (I230T)
Ref Sequence ENSEMBL: ENSMUSP00000052742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055754] [ENSMUST00000105650] [ENSMUST00000105651]
AlphaFold Q8K0Z9
Predicted Effect probably damaging
Transcript: ENSMUST00000055754
AA Change: I230T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052742
Gene: ENSMUSG00000042804
AA Change: I230T

DomainStartEndE-ValueType
Pfam:7tm_1 24 298 1.2e-14 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105650
AA Change: I230T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101275
Gene: ENSMUSG00000042804
AA Change: I230T

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.4e-18 PFAM
low complexity region 478 495 N/A INTRINSIC
low complexity region 582 594 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105651
AA Change: I230T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101276
Gene: ENSMUSG00000042804
AA Change: I230T

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.3e-17 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that belongs to the Class A rhodopsin superfamily of G protein coupled receptors. The encoded protein is expressed primarily in the central nervous system. A knockdown of the orthologous gene in rat is associated with a significant reduction in food intake and impaired decision making ability. Mutations in this gene are associated with schizophrenia, autism, and other neuropsychiatric disorders. The expression of this gene is activated by the glioma-associated oncogene homolog 1 transcription factor which, in turn, is activated by sonic hedgehog in normal and tumorigenic cells. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,411,713 (GRCm39) V595A probably benign Het
A430033K04Rik A G 5: 138,645,315 (GRCm39) E400G possibly damaging Het
Abca16 C T 7: 120,065,005 (GRCm39) T554I probably damaging Het
Acadm T A 3: 153,650,035 (GRCm39) R10W possibly damaging Het
Arhgap45 G A 10: 79,863,706 (GRCm39) A819T probably damaging Het
Arhgef25 A G 10: 127,023,048 (GRCm39) W120R probably damaging Het
Atg7 A T 6: 114,678,151 (GRCm39) Q347L probably benign Het
Atl2 T C 17: 80,163,690 (GRCm39) I316V possibly damaging Het
B4galnt3 A T 6: 120,183,577 (GRCm39) probably null Het
Baiap2l1 A T 5: 144,214,502 (GRCm39) Y397* probably null Het
Cacna1b A G 2: 24,568,886 (GRCm39) probably null Het
Capn10 T C 1: 92,862,686 (GRCm39) S31P probably damaging Het
Casp8ap2 C T 4: 32,615,490 (GRCm39) probably benign Het
Ccdc122 A T 14: 77,329,318 (GRCm39) I124L probably benign Het
Ccdc90b A G 7: 92,210,750 (GRCm39) S3G probably benign Het
Cdc14b A T 13: 64,363,549 (GRCm39) probably null Het
Chd5 T A 4: 152,461,040 (GRCm39) M1210K probably benign Het
Clec18a T G 8: 111,807,551 (GRCm39) K133T probably damaging Het
Cog4 T A 8: 111,592,663 (GRCm39) M413K probably damaging Het
Cpa5 A T 6: 30,624,594 (GRCm39) I145L probably benign Het
Ctdspl2 T G 2: 121,837,423 (GRCm39) S397A probably benign Het
Dnah8 T A 17: 30,892,797 (GRCm39) I794N probably damaging Het
Ednrb T A 14: 104,060,640 (GRCm39) T218S possibly damaging Het
Eif3b T A 5: 140,412,530 (GRCm39) probably null Het
Fanci A C 7: 79,083,305 (GRCm39) probably null Het
Fat2 C T 11: 55,161,281 (GRCm39) V3150M probably damaging Het
Fat3 T C 9: 15,858,792 (GRCm39) Y3808C probably damaging Het
Gabrr1 T A 4: 33,162,718 (GRCm39) L428Q probably damaging Het
Garnl3 G C 2: 32,905,235 (GRCm39) P488R possibly damaging Het
Gli3 T C 13: 15,894,793 (GRCm39) S656P probably benign Het
Hoxc6 A G 15: 102,918,293 (GRCm39) N86D probably benign Het
Iqch T G 9: 63,336,312 (GRCm39) R985S probably damaging Het
Jun T A 4: 94,938,559 (GRCm39) N317I probably damaging Het
Kif26a T G 12: 112,141,752 (GRCm39) probably null Het
Map4k3 T C 17: 80,913,289 (GRCm39) H627R possibly damaging Het
Misp T A 10: 79,662,300 (GRCm39) I239N probably benign Het
Mpzl2 T A 9: 44,955,019 (GRCm39) V27E probably damaging Het
Mta3 T C 17: 84,099,090 (GRCm39) S385P probably damaging Het
Muc5b G A 7: 141,414,737 (GRCm39) S2561N unknown Het
Myh8 A G 11: 67,179,092 (GRCm39) H495R probably benign Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nlrp5 A T 7: 23,133,135 (GRCm39) T927S probably benign Het
Nr5a2 T A 1: 136,868,385 (GRCm39) D310V probably benign Het
Nrbp1 A G 5: 31,403,147 (GRCm39) T207A probably damaging Het
Nxf1 G T 19: 8,748,414 (GRCm39) L14F probably benign Het
Or2a25 G A 6: 42,889,125 (GRCm39) A223T possibly damaging Het
Or6c207 T A 10: 129,104,917 (GRCm39) N92Y possibly damaging Het
Pcdhb15 A G 18: 37,608,637 (GRCm39) E623G probably damaging Het
Pid1 T C 1: 84,262,721 (GRCm39) probably null Het
Plcb2 C A 2: 118,541,934 (GRCm39) R892L possibly damaging Het
Polr1a C G 6: 71,897,733 (GRCm39) P243A probably benign Het
Pot1a A G 6: 25,758,802 (GRCm39) *326Q probably null Het
Ppp5c G T 7: 16,741,071 (GRCm39) F335L probably damaging Het
Prl8a2 T C 13: 27,536,794 (GRCm39) Y139H probably benign Het
Rogdi G T 16: 4,829,601 (GRCm39) R93S probably benign Het
Rsph6a C A 7: 18,791,505 (GRCm39) R225S probably damaging Het
Septin8 T C 11: 53,428,684 (GRCm39) S408P possibly damaging Het
Sf3a2 T A 10: 80,639,131 (GRCm39) probably null Het
Shank3 T C 15: 89,433,043 (GRCm39) S1263P possibly damaging Het
Speer4f2 A C 5: 17,579,459 (GRCm39) D86A Het
Spmip8 A T 8: 96,046,686 (GRCm39) I120F probably damaging Het
Stard9 T C 2: 120,530,529 (GRCm39) F2262S possibly damaging Het
Svep1 T A 4: 58,069,378 (GRCm39) I2803F probably benign Het
Taf1c C T 8: 120,329,565 (GRCm39) probably null Het
Tasor2 G A 13: 3,624,881 (GRCm39) Q1690* probably null Het
Tfap2a C T 13: 40,872,744 (GRCm39) V317I probably benign Het
Thnsl2 T C 6: 71,106,317 (GRCm39) T370A probably benign Het
Tmem201 C T 4: 149,803,177 (GRCm39) G564S probably benign Het
Ttc41 A C 10: 86,612,030 (GRCm39) E1101A probably damaging Het
Ugcg T A 4: 59,211,974 (GRCm39) F113L possibly damaging Het
Unc80 G T 1: 66,690,692 (GRCm39) V2456L probably benign Het
Vav3 A T 3: 109,331,323 (GRCm39) N74I probably damaging Het
Vmn2r25 T A 6: 123,829,976 (GRCm39) R58S probably benign Het
Wdr97 C A 15: 76,247,819 (GRCm39) F1614L Het
Ylpm1 T A 12: 85,080,801 (GRCm39) M1499K probably benign Het
Zfp647 A G 15: 76,795,571 (GRCm39) V363A possibly damaging Het
Other mutations in Gpr153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Gpr153 APN 4 152,366,423 (GRCm39) unclassified probably benign
IGL01368:Gpr153 APN 4 152,367,451 (GRCm39) missense probably benign 0.40
IGL01568:Gpr153 APN 4 152,366,825 (GRCm39) splice site probably null
IGL01672:Gpr153 APN 4 152,364,370 (GRCm39) nonsense probably null
R0735:Gpr153 UTSW 4 152,363,830 (GRCm39) nonsense probably null
R0925:Gpr153 UTSW 4 152,366,331 (GRCm39) missense probably benign
R1302:Gpr153 UTSW 4 152,364,400 (GRCm39) missense probably damaging 1.00
R1829:Gpr153 UTSW 4 152,366,849 (GRCm39) missense possibly damaging 0.70
R2041:Gpr153 UTSW 4 152,367,810 (GRCm39) missense probably benign
R4698:Gpr153 UTSW 4 152,366,240 (GRCm39) missense probably damaging 1.00
R5069:Gpr153 UTSW 4 152,364,340 (GRCm39) missense probably damaging 0.99
R5623:Gpr153 UTSW 4 152,366,398 (GRCm39) missense possibly damaging 0.89
R5800:Gpr153 UTSW 4 152,364,534 (GRCm39) nonsense probably null
R5940:Gpr153 UTSW 4 152,367,832 (GRCm39) missense probably benign 0.12
R6773:Gpr153 UTSW 4 152,363,757 (GRCm39) missense probably damaging 1.00
R6944:Gpr153 UTSW 4 152,363,820 (GRCm39) missense probably damaging 1.00
R7486:Gpr153 UTSW 4 152,366,858 (GRCm39) missense probably benign 0.01
R8699:Gpr153 UTSW 4 152,363,558 (GRCm39) start gained probably benign
R8701:Gpr153 UTSW 4 152,363,558 (GRCm39) start gained probably benign
R8732:Gpr153 UTSW 4 152,363,558 (GRCm39) start gained probably benign
R9047:Gpr153 UTSW 4 152,364,664 (GRCm39) missense probably damaging 1.00
R9383:Gpr153 UTSW 4 152,367,516 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGAGCGAGCGTTTCTACAC -3'
(R):5'- GTCAGGTTTATCATTTCAGCCATC -3'

Sequencing Primer
(F):5'- AGCGTTTCTACACCCACGG -3'
(R):5'- ATTTCAGCCATCAGTCCCCAGG -3'
Posted On 2020-07-13