Incidental Mutation 'R8170:Speer4f2'
ID 634026
Institutional Source Beutler Lab
Gene Symbol Speer4f2
Ensembl Gene ENSMUSG00000091827
Gene Name spermatogenesis associated glutamate (E)-rich protein 4f2
Synonyms Gm3535, Gm3495
MMRRC Submission 067596-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.131) question?
Stock # R8170 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 17578184-17582990 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 17579459 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 86 (D86A)
Ref Sequence ENSEMBL: ENSMUSP00000129818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166086]
AlphaFold E9Q366
Predicted Effect
SMART Domains Protein: ENSMUSP00000129818
Gene: ENSMUSG00000091827
AA Change: D86A

DomainStartEndE-ValueType
Pfam:Takusan 34 112 9.6e-20 PFAM
low complexity region 208 253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,411,713 (GRCm39) V595A probably benign Het
A430033K04Rik A G 5: 138,645,315 (GRCm39) E400G possibly damaging Het
Abca16 C T 7: 120,065,005 (GRCm39) T554I probably damaging Het
Acadm T A 3: 153,650,035 (GRCm39) R10W possibly damaging Het
Arhgap45 G A 10: 79,863,706 (GRCm39) A819T probably damaging Het
Arhgef25 A G 10: 127,023,048 (GRCm39) W120R probably damaging Het
Atg7 A T 6: 114,678,151 (GRCm39) Q347L probably benign Het
Atl2 T C 17: 80,163,690 (GRCm39) I316V possibly damaging Het
B4galnt3 A T 6: 120,183,577 (GRCm39) probably null Het
Baiap2l1 A T 5: 144,214,502 (GRCm39) Y397* probably null Het
Cacna1b A G 2: 24,568,886 (GRCm39) probably null Het
Capn10 T C 1: 92,862,686 (GRCm39) S31P probably damaging Het
Casp8ap2 C T 4: 32,615,490 (GRCm39) probably benign Het
Ccdc122 A T 14: 77,329,318 (GRCm39) I124L probably benign Het
Ccdc90b A G 7: 92,210,750 (GRCm39) S3G probably benign Het
Cdc14b A T 13: 64,363,549 (GRCm39) probably null Het
Chd5 T A 4: 152,461,040 (GRCm39) M1210K probably benign Het
Clec18a T G 8: 111,807,551 (GRCm39) K133T probably damaging Het
Cog4 T A 8: 111,592,663 (GRCm39) M413K probably damaging Het
Cpa5 A T 6: 30,624,594 (GRCm39) I145L probably benign Het
Ctdspl2 T G 2: 121,837,423 (GRCm39) S397A probably benign Het
Dnah8 T A 17: 30,892,797 (GRCm39) I794N probably damaging Het
Ednrb T A 14: 104,060,640 (GRCm39) T218S possibly damaging Het
Eif3b T A 5: 140,412,530 (GRCm39) probably null Het
Fanci A C 7: 79,083,305 (GRCm39) probably null Het
Fat2 C T 11: 55,161,281 (GRCm39) V3150M probably damaging Het
Fat3 T C 9: 15,858,792 (GRCm39) Y3808C probably damaging Het
Gabrr1 T A 4: 33,162,718 (GRCm39) L428Q probably damaging Het
Garnl3 G C 2: 32,905,235 (GRCm39) P488R possibly damaging Het
Gli3 T C 13: 15,894,793 (GRCm39) S656P probably benign Het
Gpr153 T C 4: 152,364,634 (GRCm39) I230T probably damaging Het
Hoxc6 A G 15: 102,918,293 (GRCm39) N86D probably benign Het
Iqch T G 9: 63,336,312 (GRCm39) R985S probably damaging Het
Jun T A 4: 94,938,559 (GRCm39) N317I probably damaging Het
Kif26a T G 12: 112,141,752 (GRCm39) probably null Het
Map4k3 T C 17: 80,913,289 (GRCm39) H627R possibly damaging Het
Misp T A 10: 79,662,300 (GRCm39) I239N probably benign Het
Mpzl2 T A 9: 44,955,019 (GRCm39) V27E probably damaging Het
Mta3 T C 17: 84,099,090 (GRCm39) S385P probably damaging Het
Muc5b G A 7: 141,414,737 (GRCm39) S2561N unknown Het
Myh8 A G 11: 67,179,092 (GRCm39) H495R probably benign Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nlrp5 A T 7: 23,133,135 (GRCm39) T927S probably benign Het
Nr5a2 T A 1: 136,868,385 (GRCm39) D310V probably benign Het
Nrbp1 A G 5: 31,403,147 (GRCm39) T207A probably damaging Het
Nxf1 G T 19: 8,748,414 (GRCm39) L14F probably benign Het
Or2a25 G A 6: 42,889,125 (GRCm39) A223T possibly damaging Het
Or6c207 T A 10: 129,104,917 (GRCm39) N92Y possibly damaging Het
Pcdhb15 A G 18: 37,608,637 (GRCm39) E623G probably damaging Het
Pid1 T C 1: 84,262,721 (GRCm39) probably null Het
Plcb2 C A 2: 118,541,934 (GRCm39) R892L possibly damaging Het
Polr1a C G 6: 71,897,733 (GRCm39) P243A probably benign Het
Pot1a A G 6: 25,758,802 (GRCm39) *326Q probably null Het
Ppp5c G T 7: 16,741,071 (GRCm39) F335L probably damaging Het
Prl8a2 T C 13: 27,536,794 (GRCm39) Y139H probably benign Het
Rogdi G T 16: 4,829,601 (GRCm39) R93S probably benign Het
Rsph6a C A 7: 18,791,505 (GRCm39) R225S probably damaging Het
Septin8 T C 11: 53,428,684 (GRCm39) S408P possibly damaging Het
Sf3a2 T A 10: 80,639,131 (GRCm39) probably null Het
Shank3 T C 15: 89,433,043 (GRCm39) S1263P possibly damaging Het
Spmip8 A T 8: 96,046,686 (GRCm39) I120F probably damaging Het
Stard9 T C 2: 120,530,529 (GRCm39) F2262S possibly damaging Het
Svep1 T A 4: 58,069,378 (GRCm39) I2803F probably benign Het
Taf1c C T 8: 120,329,565 (GRCm39) probably null Het
Tasor2 G A 13: 3,624,881 (GRCm39) Q1690* probably null Het
Tfap2a C T 13: 40,872,744 (GRCm39) V317I probably benign Het
Thnsl2 T C 6: 71,106,317 (GRCm39) T370A probably benign Het
Tmem201 C T 4: 149,803,177 (GRCm39) G564S probably benign Het
Ttc41 A C 10: 86,612,030 (GRCm39) E1101A probably damaging Het
Ugcg T A 4: 59,211,974 (GRCm39) F113L possibly damaging Het
Unc80 G T 1: 66,690,692 (GRCm39) V2456L probably benign Het
Vav3 A T 3: 109,331,323 (GRCm39) N74I probably damaging Het
Vmn2r25 T A 6: 123,829,976 (GRCm39) R58S probably benign Het
Wdr97 C A 15: 76,247,819 (GRCm39) F1614L Het
Ylpm1 T A 12: 85,080,801 (GRCm39) M1499K probably benign Het
Zfp647 A G 15: 76,795,571 (GRCm39) V363A possibly damaging Het
Other mutations in Speer4f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Speer4f2 APN 5 17,581,565 (GRCm39) missense possibly damaging 0.94
IGL02092:Speer4f2 APN 5 17,581,627 (GRCm39) nonsense probably null
IGL03100:Speer4f2 APN 5 17,581,528 (GRCm39) missense probably damaging 0.99
R0939:Speer4f2 UTSW 5 17,579,402 (GRCm39) missense probably damaging 0.99
R1384:Speer4f2 UTSW 5 17,579,447 (GRCm39) missense probably damaging 1.00
R1528:Speer4f2 UTSW 5 17,581,540 (GRCm39) missense
R1873:Speer4f2 UTSW 5 17,579,447 (GRCm39) missense probably damaging 1.00
R3608:Speer4f2 UTSW 5 17,579,492 (GRCm39) missense probably benign 0.03
R4972:Speer4f2 UTSW 5 17,579,423 (GRCm39) missense probably benign 0.27
R5421:Speer4f2 UTSW 5 17,579,356 (GRCm39) missense possibly damaging 0.88
R5450:Speer4f2 UTSW 5 17,578,217 (GRCm39) missense possibly damaging 0.85
R5452:Speer4f2 UTSW 5 17,581,498 (GRCm39) missense possibly damaging 0.93
R5531:Speer4f2 UTSW 5 17,581,526 (GRCm39) missense possibly damaging 0.57
R5924:Speer4f2 UTSW 5 17,581,622 (GRCm39) missense probably damaging 1.00
R6454:Speer4f2 UTSW 5 17,579,431 (GRCm39) missense probably damaging 0.99
R6553:Speer4f2 UTSW 5 17,579,420 (GRCm39) missense probably damaging 1.00
R6585:Speer4f2 UTSW 5 17,579,420 (GRCm39) missense probably damaging 1.00
R6649:Speer4f2 UTSW 5 17,580,767 (GRCm39) missense probably benign 0.05
R6878:Speer4f2 UTSW 5 17,580,765 (GRCm39) missense probably damaging 0.99
R7089:Speer4f2 UTSW 5 17,581,661 (GRCm39) missense
R7129:Speer4f2 UTSW 5 17,582,446 (GRCm39) missense
R7448:Speer4f2 UTSW 5 17,581,540 (GRCm39) missense
R7654:Speer4f2 UTSW 5 17,579,413 (GRCm39) missense
R7942:Speer4f2 UTSW 5 17,582,630 (GRCm39) missense unknown
R8409:Speer4f2 UTSW 5 17,582,419 (GRCm39) missense
R9154:Speer4f2 UTSW 5 17,581,610 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GGCATGTATTCCTTCTCTGTAGACAG -3'
(R):5'- CTCCTGACAAAGCTTCAGGC -3'

Sequencing Primer
(F):5'- CTGTAGACAGTCTAAACTCTTTGC -3'
(R):5'- CAAAGCTTCAGGCCTTGC -3'
Posted On 2020-07-13