Incidental Mutation 'R8170:A430033K04Rik'
ID634028
Institutional Source Beutler Lab
Gene Symbol A430033K04Rik
Ensembl Gene ENSMUSG00000056014
Gene NameRIKEN cDNA A430033K04 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8170 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location138622859-138652414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138647053 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 400 (E400G)
Ref Sequence ENSEMBL: ENSMUSP00000067316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069862] [ENSMUST00000198958]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069862
AA Change: E400G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000067316
Gene: ENSMUSG00000056014
AA Change: E400G

DomainStartEndE-ValueType
KRAB 16 76 6.23e-34 SMART
ZnF_C2H2 261 280 1.01e2 SMART
ZnF_C2H2 455 477 1.47e-3 SMART
ZnF_C2H2 483 505 4.05e-1 SMART
ZnF_C2H2 511 533 5.5e-3 SMART
ZnF_C2H2 539 561 7.26e-3 SMART
ZnF_C2H2 567 589 5.14e-3 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 1.92e-2 SMART
ZnF_C2H2 651 673 2.12e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198958
AA Change: E400G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142904
Gene: ENSMUSG00000056014
AA Change: E400G

DomainStartEndE-ValueType
KRAB 16 76 2.7e-36 SMART
ZnF_C2H2 261 280 4.2e-1 SMART
ZnF_C2H2 455 477 6.4e-6 SMART
ZnF_C2H2 483 505 1.8e-3 SMART
ZnF_C2H2 511 533 2.3e-5 SMART
ZnF_C2H2 539 561 3e-5 SMART
ZnF_C2H2 567 589 2.1e-5 SMART
ZnF_C2H2 595 617 1.5e-5 SMART
ZnF_C2H2 623 643 2.7e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,263,594 V595A probably benign Het
Abca16 C T 7: 120,465,782 T554I probably damaging Het
Acadm T A 3: 153,944,398 R10W possibly damaging Het
Arhgef25 A G 10: 127,187,179 W120R probably damaging Het
Atg7 A T 6: 114,701,190 Q347L probably benign Het
Atl2 T C 17: 79,856,261 I316V possibly damaging Het
B4galnt3 A T 6: 120,206,616 probably null Het
Baiap2l1 A T 5: 144,277,692 Y397* probably null Het
Cacna1b A G 2: 24,678,874 probably null Het
Capn10 T C 1: 92,934,964 S31P probably damaging Het
Casp8ap2 C T 4: 32,615,490 probably benign Het
Ccdc122 A T 14: 77,091,878 I124L probably benign Het
Ccdc90b A G 7: 92,561,542 S3G probably benign Het
Cdc14b A T 13: 64,215,735 probably null Het
Chd5 T A 4: 152,376,583 M1210K probably benign Het
Clec18a T G 8: 111,080,919 K133T probably damaging Het
Cog4 T A 8: 110,866,031 M413K probably damaging Het
Cpa5 A T 6: 30,624,595 I145L probably benign Het
Ctdspl2 T G 2: 122,006,942 S397A probably benign Het
Dnah8 T A 17: 30,673,823 I794N probably damaging Het
Ednrb T A 14: 103,823,204 T218S possibly damaging Het
Eif3b T A 5: 140,426,775 probably null Het
Fam208b G A 13: 3,574,881 Q1690* probably null Het
Fanci A C 7: 79,433,557 probably null Het
Fat2 C T 11: 55,270,455 V3150M probably damaging Het
Fat3 T C 9: 15,947,496 Y3808C probably damaging Het
Gabrr1 T A 4: 33,162,718 L428Q probably damaging Het
Garnl3 G C 2: 33,015,223 P488R possibly damaging Het
Gli3 T C 13: 15,720,208 S656P probably benign Het
Gm35339 C A 15: 76,363,619 F1614L Het
Gpr153 T C 4: 152,280,177 I230T probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hoxc6 A G 15: 103,009,861 N86D probably benign Het
Iqch T G 9: 63,429,030 R985S probably damaging Het
Jun T A 4: 95,050,322 N317I probably damaging Het
Kif26a T G 12: 112,175,318 probably null Het
Map4k3 T C 17: 80,605,860 H627R possibly damaging Het
Misp T A 10: 79,826,466 I239N probably benign Het
Mpzl2 T A 9: 45,043,721 V27E probably damaging Het
Mta3 T C 17: 83,791,661 S385P probably damaging Het
Muc5b G A 7: 141,861,000 S2561N unknown Het
Myh8 A G 11: 67,288,266 H495R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp5 A T 7: 23,433,710 T927S probably benign Het
Nr5a2 T A 1: 136,940,647 D310V probably benign Het
Nrbp1 A G 5: 31,245,803 T207A probably damaging Het
Nxf1 G T 19: 8,771,050 L14F probably benign Het
Olfr447 G A 6: 42,912,191 A223T possibly damaging Het
Olfr777 T A 10: 129,269,048 N92Y possibly damaging Het
Pcdhb15 A G 18: 37,475,584 E623G probably damaging Het
Pid1 T C 1: 84,285,000 probably null Het
Plcb2 C A 2: 118,711,453 R892L possibly damaging Het
Polr1a C G 6: 71,920,749 P243A probably benign Het
Pot1a A G 6: 25,758,803 *326Q probably null Het
Ppp5c G T 7: 17,007,146 F335L probably damaging Het
Prl8a2 T C 13: 27,352,811 Y139H probably benign Het
Rogdi G T 16: 5,011,737 R93S probably benign Het
Rsph6a C A 7: 19,057,580 R225S probably damaging Het
Sept8 T C 11: 53,537,857 S408P possibly damaging Het
Sf3a2 T A 10: 80,803,297 probably null Het
Shank3 T C 15: 89,548,840 S1263P possibly damaging Het
Speer4f2 A C 5: 17,374,461 D86A Het
Stard9 T C 2: 120,700,048 F2262S possibly damaging Het
Svep1 T A 4: 58,069,378 I2803F probably benign Het
Taf1c C T 8: 119,602,826 probably null Het
Tepp A T 8: 95,320,058 I120F probably damaging Het
Tfap2a C T 13: 40,719,268 V317I probably benign Het
Thnsl2 T C 6: 71,129,333 T370A probably benign Het
Tmem201 C T 4: 149,718,720 G564S probably benign Het
Ttc41 A C 10: 86,776,166 E1101A probably damaging Het
Ugcg T A 4: 59,211,974 F113L possibly damaging Het
Unc80 G T 1: 66,651,533 V2456L probably benign Het
Vav3 A T 3: 109,424,007 N74I probably damaging Het
Vmn2r25 T A 6: 123,853,017 R58S probably benign Het
Ylpm1 T A 12: 85,034,027 M1499K probably benign Het
Zfp647 A G 15: 76,911,371 V363A possibly damaging Het
Other mutations in A430033K04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:A430033K04Rik APN 5 138647592 missense probably damaging 1.00
IGL00336:A430033K04Rik APN 5 138647104 missense probably damaging 0.99
IGL02615:A430033K04Rik APN 5 138646140 nonsense probably null
IGL03354:A430033K04Rik APN 5 138646779 missense possibly damaging 0.85
R0172:A430033K04Rik UTSW 5 138647316 missense probably damaging 0.99
R1769:A430033K04Rik UTSW 5 138646257 missense probably benign 0.04
R4515:A430033K04Rik UTSW 5 138647744 missense probably damaging 1.00
R4903:A430033K04Rik UTSW 5 138646857 nonsense probably null
R4964:A430033K04Rik UTSW 5 138646857 nonsense probably null
R5389:A430033K04Rik UTSW 5 138646297 missense probably benign 0.02
R5769:A430033K04Rik UTSW 5 138646333 missense possibly damaging 0.86
R6128:A430033K04Rik UTSW 5 138647776 missense probably damaging 1.00
R6399:A430033K04Rik UTSW 5 138647559 missense probably damaging 1.00
R6444:A430033K04Rik UTSW 5 138639569 small deletion probably benign
R6600:A430033K04Rik UTSW 5 138647448 frame shift probably null
R6774:A430033K04Rik UTSW 5 138646450 missense probably benign
R7098:A430033K04Rik UTSW 5 138646522 missense probably benign
R7217:A430033K04Rik UTSW 5 138646926 missense probably benign
R7269:A430033K04Rik UTSW 5 138646752 missense possibly damaging 0.86
R7429:A430033K04Rik UTSW 5 138636183 missense possibly damaging 0.92
R7442:A430033K04Rik UTSW 5 138647247 missense possibly damaging 0.55
R7718:A430033K04Rik UTSW 5 138647860 missense possibly damaging 0.73
R8007:A430033K04Rik UTSW 5 138646639 missense probably benign 0.33
R8348:A430033K04Rik UTSW 5 138636252 missense probably damaging 1.00
R8496:A430033K04Rik UTSW 5 138646858 missense probably benign 0.00
R8520:A430033K04Rik UTSW 5 138646706 missense possibly damaging 0.72
R8778:A430033K04Rik UTSW 5 138646887 missense possibly damaging 0.53
R8858:A430033K04Rik UTSW 5 138640076 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATCCAGAACTTCACGGAGAG -3'
(R):5'- TAGAGTGAGCTGTGACCTCAG -3'

Sequencing Primer
(F):5'- CTTCACGGAGAGAAACAAGTTTAC -3'
(R):5'- ACTTGTGACAGAAGGCTTTCC -3'
Posted On2020-07-13