Incidental Mutation 'R8170:Thnsl2'
ID 634033
Institutional Source Beutler Lab
Gene Symbol Thnsl2
Ensembl Gene ENSMUSG00000054474
Gene Name threonine synthase-like 2 (bacterial)
Synonyms TSH2
MMRRC Submission 067596-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R8170 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 71105150-71121364 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71106317 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 370 (T370A)
Ref Sequence ENSEMBL: ENSMUSP00000073861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074241] [ENSMUST00000160918]
AlphaFold Q80W22
Predicted Effect probably benign
Transcript: ENSMUST00000074241
AA Change: T370A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073861
Gene: ENSMUSG00000054474
AA Change: T370A

DomainStartEndE-ValueType
Pfam:Thr_synth_N 2 81 2.4e-27 PFAM
Pfam:PALP 93 415 9.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160918
AA Change: T370A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124423
Gene: ENSMUSG00000054474
AA Change: T370A

DomainStartEndE-ValueType
Pfam:Thr_synth_N 2 81 1.1e-27 PFAM
Pfam:PALP 94 413 8.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170753
SMART Domains Protein: ENSMUSP00000129994
Gene: ENSMUSG00000054474

DomainStartEndE-ValueType
PDB:4F4F|B 2 122 1e-11 PDB
SCOP:d1kl7a_ 2 129 1e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a threonine synthase-like protein. A similar enzyme in mouse can catalyze the degradation of O-phospho-homoserine to a-ketobutyrate, phosphate, and ammonia. This protein also has phospho-lyase activity on both gamma and beta phosphorylated substrates. In mouse an alternatively spliced form of this protein has been shown to act as a cytokine and can induce the production of the inflammatory cytokine IL6 in osteoblasts. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,411,713 (GRCm39) V595A probably benign Het
A430033K04Rik A G 5: 138,645,315 (GRCm39) E400G possibly damaging Het
Abca16 C T 7: 120,065,005 (GRCm39) T554I probably damaging Het
Acadm T A 3: 153,650,035 (GRCm39) R10W possibly damaging Het
Arhgap45 G A 10: 79,863,706 (GRCm39) A819T probably damaging Het
Arhgef25 A G 10: 127,023,048 (GRCm39) W120R probably damaging Het
Atg7 A T 6: 114,678,151 (GRCm39) Q347L probably benign Het
Atl2 T C 17: 80,163,690 (GRCm39) I316V possibly damaging Het
B4galnt3 A T 6: 120,183,577 (GRCm39) probably null Het
Baiap2l1 A T 5: 144,214,502 (GRCm39) Y397* probably null Het
Cacna1b A G 2: 24,568,886 (GRCm39) probably null Het
Capn10 T C 1: 92,862,686 (GRCm39) S31P probably damaging Het
Casp8ap2 C T 4: 32,615,490 (GRCm39) probably benign Het
Ccdc122 A T 14: 77,329,318 (GRCm39) I124L probably benign Het
Ccdc90b A G 7: 92,210,750 (GRCm39) S3G probably benign Het
Cdc14b A T 13: 64,363,549 (GRCm39) probably null Het
Chd5 T A 4: 152,461,040 (GRCm39) M1210K probably benign Het
Clec18a T G 8: 111,807,551 (GRCm39) K133T probably damaging Het
Cog4 T A 8: 111,592,663 (GRCm39) M413K probably damaging Het
Cpa5 A T 6: 30,624,594 (GRCm39) I145L probably benign Het
Ctdspl2 T G 2: 121,837,423 (GRCm39) S397A probably benign Het
Dnah8 T A 17: 30,892,797 (GRCm39) I794N probably damaging Het
Ednrb T A 14: 104,060,640 (GRCm39) T218S possibly damaging Het
Eif3b T A 5: 140,412,530 (GRCm39) probably null Het
Fanci A C 7: 79,083,305 (GRCm39) probably null Het
Fat2 C T 11: 55,161,281 (GRCm39) V3150M probably damaging Het
Fat3 T C 9: 15,858,792 (GRCm39) Y3808C probably damaging Het
Gabrr1 T A 4: 33,162,718 (GRCm39) L428Q probably damaging Het
Garnl3 G C 2: 32,905,235 (GRCm39) P488R possibly damaging Het
Gli3 T C 13: 15,894,793 (GRCm39) S656P probably benign Het
Gpr153 T C 4: 152,364,634 (GRCm39) I230T probably damaging Het
Hoxc6 A G 15: 102,918,293 (GRCm39) N86D probably benign Het
Iqch T G 9: 63,336,312 (GRCm39) R985S probably damaging Het
Jun T A 4: 94,938,559 (GRCm39) N317I probably damaging Het
Kif26a T G 12: 112,141,752 (GRCm39) probably null Het
Map4k3 T C 17: 80,913,289 (GRCm39) H627R possibly damaging Het
Misp T A 10: 79,662,300 (GRCm39) I239N probably benign Het
Mpzl2 T A 9: 44,955,019 (GRCm39) V27E probably damaging Het
Mta3 T C 17: 84,099,090 (GRCm39) S385P probably damaging Het
Muc5b G A 7: 141,414,737 (GRCm39) S2561N unknown Het
Myh8 A G 11: 67,179,092 (GRCm39) H495R probably benign Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nlrp5 A T 7: 23,133,135 (GRCm39) T927S probably benign Het
Nr5a2 T A 1: 136,868,385 (GRCm39) D310V probably benign Het
Nrbp1 A G 5: 31,403,147 (GRCm39) T207A probably damaging Het
Nxf1 G T 19: 8,748,414 (GRCm39) L14F probably benign Het
Or2a25 G A 6: 42,889,125 (GRCm39) A223T possibly damaging Het
Or6c207 T A 10: 129,104,917 (GRCm39) N92Y possibly damaging Het
Pcdhb15 A G 18: 37,608,637 (GRCm39) E623G probably damaging Het
Pid1 T C 1: 84,262,721 (GRCm39) probably null Het
Plcb2 C A 2: 118,541,934 (GRCm39) R892L possibly damaging Het
Polr1a C G 6: 71,897,733 (GRCm39) P243A probably benign Het
Pot1a A G 6: 25,758,802 (GRCm39) *326Q probably null Het
Ppp5c G T 7: 16,741,071 (GRCm39) F335L probably damaging Het
Prl8a2 T C 13: 27,536,794 (GRCm39) Y139H probably benign Het
Rogdi G T 16: 4,829,601 (GRCm39) R93S probably benign Het
Rsph6a C A 7: 18,791,505 (GRCm39) R225S probably damaging Het
Septin8 T C 11: 53,428,684 (GRCm39) S408P possibly damaging Het
Sf3a2 T A 10: 80,639,131 (GRCm39) probably null Het
Shank3 T C 15: 89,433,043 (GRCm39) S1263P possibly damaging Het
Speer4f2 A C 5: 17,579,459 (GRCm39) D86A Het
Spmip8 A T 8: 96,046,686 (GRCm39) I120F probably damaging Het
Stard9 T C 2: 120,530,529 (GRCm39) F2262S possibly damaging Het
Svep1 T A 4: 58,069,378 (GRCm39) I2803F probably benign Het
Taf1c C T 8: 120,329,565 (GRCm39) probably null Het
Tasor2 G A 13: 3,624,881 (GRCm39) Q1690* probably null Het
Tfap2a C T 13: 40,872,744 (GRCm39) V317I probably benign Het
Tmem201 C T 4: 149,803,177 (GRCm39) G564S probably benign Het
Ttc41 A C 10: 86,612,030 (GRCm39) E1101A probably damaging Het
Ugcg T A 4: 59,211,974 (GRCm39) F113L possibly damaging Het
Unc80 G T 1: 66,690,692 (GRCm39) V2456L probably benign Het
Vav3 A T 3: 109,331,323 (GRCm39) N74I probably damaging Het
Vmn2r25 T A 6: 123,829,976 (GRCm39) R58S probably benign Het
Wdr97 C A 15: 76,247,819 (GRCm39) F1614L Het
Ylpm1 T A 12: 85,080,801 (GRCm39) M1499K probably benign Het
Zfp647 A G 15: 76,795,571 (GRCm39) V363A possibly damaging Het
Other mutations in Thnsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thnsl2 APN 6 71,108,884 (GRCm39) missense probably damaging 1.00
IGL00814:Thnsl2 APN 6 71,116,867 (GRCm39) missense probably damaging 1.00
IGL01139:Thnsl2 APN 6 71,115,718 (GRCm39) missense probably damaging 1.00
IGL01380:Thnsl2 APN 6 71,115,740 (GRCm39) missense probably benign
IGL01511:Thnsl2 APN 6 71,116,777 (GRCm39) missense probably benign 0.04
IGL02000:Thnsl2 APN 6 71,111,203 (GRCm39) missense probably damaging 1.00
IGL03157:Thnsl2 APN 6 71,108,930 (GRCm39) missense probably benign 0.00
R0372:Thnsl2 UTSW 6 71,116,774 (GRCm39) missense probably damaging 1.00
R0380:Thnsl2 UTSW 6 71,118,314 (GRCm39) missense probably damaging 1.00
R0521:Thnsl2 UTSW 6 71,111,243 (GRCm39) missense probably damaging 1.00
R0815:Thnsl2 UTSW 6 71,111,208 (GRCm39) nonsense probably null
R0863:Thnsl2 UTSW 6 71,111,208 (GRCm39) nonsense probably null
R1300:Thnsl2 UTSW 6 71,111,175 (GRCm39) missense probably damaging 1.00
R2867:Thnsl2 UTSW 6 71,108,945 (GRCm39) missense probably damaging 1.00
R2867:Thnsl2 UTSW 6 71,108,945 (GRCm39) missense probably damaging 1.00
R4767:Thnsl2 UTSW 6 71,111,279 (GRCm39) missense probably damaging 1.00
R5578:Thnsl2 UTSW 6 71,115,749 (GRCm39) missense probably benign 0.40
R5818:Thnsl2 UTSW 6 71,111,127 (GRCm39) missense probably benign 0.01
R6627:Thnsl2 UTSW 6 71,111,199 (GRCm39) missense possibly damaging 0.70
R6800:Thnsl2 UTSW 6 71,118,264 (GRCm39) missense probably benign 0.29
R7192:Thnsl2 UTSW 6 71,116,739 (GRCm39) missense probably benign 0.02
R7391:Thnsl2 UTSW 6 71,108,914 (GRCm39) missense probably damaging 1.00
R7516:Thnsl2 UTSW 6 71,108,990 (GRCm39) nonsense probably null
R7565:Thnsl2 UTSW 6 71,118,311 (GRCm39) missense probably benign 0.00
R7980:Thnsl2 UTSW 6 71,115,652 (GRCm39) missense probably damaging 1.00
R7988:Thnsl2 UTSW 6 71,118,303 (GRCm39) missense probably benign 0.38
R8917:Thnsl2 UTSW 6 71,116,927 (GRCm39) missense probably benign
R9547:Thnsl2 UTSW 6 71,116,810 (GRCm39) missense probably damaging 1.00
R9696:Thnsl2 UTSW 6 71,108,930 (GRCm39) missense possibly damaging 0.95
X0021:Thnsl2 UTSW 6 71,105,688 (GRCm39) missense probably benign 0.02
X0066:Thnsl2 UTSW 6 71,116,821 (GRCm39) nonsense probably null
Z1177:Thnsl2 UTSW 6 71,105,825 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCACGCCTACTGATGTCAC -3'
(R):5'- ACAAATCCTTCTGCTATGTAGGCC -3'

Sequencing Primer
(F):5'- GATGTCACTATCCTTAGTCTTGCATG -3'
(R):5'- GTAGGCCCCAAACTGTAATTGTC -3'
Posted On 2020-07-13