Incidental Mutation 'R8170:Abca16'
ID 634041
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene Name ATP-binding cassette, sub-family A member 16
Synonyms
MMRRC Submission 067596-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8170 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 120008870-120144036 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 120065005 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 554 (T554I)
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
AlphaFold E9PWJ7
Predicted Effect probably damaging
Transcript: ENSMUST00000056042
AA Change: T553I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: T553I

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120490
AA Change: T554I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: T554I

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (76/76)
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,411,713 (GRCm39) V595A probably benign Het
A430033K04Rik A G 5: 138,645,315 (GRCm39) E400G possibly damaging Het
Acadm T A 3: 153,650,035 (GRCm39) R10W possibly damaging Het
Arhgap45 G A 10: 79,863,706 (GRCm39) A819T probably damaging Het
Arhgef25 A G 10: 127,023,048 (GRCm39) W120R probably damaging Het
Atg7 A T 6: 114,678,151 (GRCm39) Q347L probably benign Het
Atl2 T C 17: 80,163,690 (GRCm39) I316V possibly damaging Het
B4galnt3 A T 6: 120,183,577 (GRCm39) probably null Het
Baiap2l1 A T 5: 144,214,502 (GRCm39) Y397* probably null Het
Cacna1b A G 2: 24,568,886 (GRCm39) probably null Het
Capn10 T C 1: 92,862,686 (GRCm39) S31P probably damaging Het
Casp8ap2 C T 4: 32,615,490 (GRCm39) probably benign Het
Ccdc122 A T 14: 77,329,318 (GRCm39) I124L probably benign Het
Ccdc90b A G 7: 92,210,750 (GRCm39) S3G probably benign Het
Cdc14b A T 13: 64,363,549 (GRCm39) probably null Het
Chd5 T A 4: 152,461,040 (GRCm39) M1210K probably benign Het
Clec18a T G 8: 111,807,551 (GRCm39) K133T probably damaging Het
Cog4 T A 8: 111,592,663 (GRCm39) M413K probably damaging Het
Cpa5 A T 6: 30,624,594 (GRCm39) I145L probably benign Het
Ctdspl2 T G 2: 121,837,423 (GRCm39) S397A probably benign Het
Dnah8 T A 17: 30,892,797 (GRCm39) I794N probably damaging Het
Ednrb T A 14: 104,060,640 (GRCm39) T218S possibly damaging Het
Eif3b T A 5: 140,412,530 (GRCm39) probably null Het
Fanci A C 7: 79,083,305 (GRCm39) probably null Het
Fat2 C T 11: 55,161,281 (GRCm39) V3150M probably damaging Het
Fat3 T C 9: 15,858,792 (GRCm39) Y3808C probably damaging Het
Gabrr1 T A 4: 33,162,718 (GRCm39) L428Q probably damaging Het
Garnl3 G C 2: 32,905,235 (GRCm39) P488R possibly damaging Het
Gli3 T C 13: 15,894,793 (GRCm39) S656P probably benign Het
Gpr153 T C 4: 152,364,634 (GRCm39) I230T probably damaging Het
Hoxc6 A G 15: 102,918,293 (GRCm39) N86D probably benign Het
Iqch T G 9: 63,336,312 (GRCm39) R985S probably damaging Het
Jun T A 4: 94,938,559 (GRCm39) N317I probably damaging Het
Kif26a T G 12: 112,141,752 (GRCm39) probably null Het
Map4k3 T C 17: 80,913,289 (GRCm39) H627R possibly damaging Het
Misp T A 10: 79,662,300 (GRCm39) I239N probably benign Het
Mpzl2 T A 9: 44,955,019 (GRCm39) V27E probably damaging Het
Mta3 T C 17: 84,099,090 (GRCm39) S385P probably damaging Het
Muc5b G A 7: 141,414,737 (GRCm39) S2561N unknown Het
Myh8 A G 11: 67,179,092 (GRCm39) H495R probably benign Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nlrp5 A T 7: 23,133,135 (GRCm39) T927S probably benign Het
Nr5a2 T A 1: 136,868,385 (GRCm39) D310V probably benign Het
Nrbp1 A G 5: 31,403,147 (GRCm39) T207A probably damaging Het
Nxf1 G T 19: 8,748,414 (GRCm39) L14F probably benign Het
Or2a25 G A 6: 42,889,125 (GRCm39) A223T possibly damaging Het
Or6c207 T A 10: 129,104,917 (GRCm39) N92Y possibly damaging Het
Pcdhb15 A G 18: 37,608,637 (GRCm39) E623G probably damaging Het
Pid1 T C 1: 84,262,721 (GRCm39) probably null Het
Plcb2 C A 2: 118,541,934 (GRCm39) R892L possibly damaging Het
Polr1a C G 6: 71,897,733 (GRCm39) P243A probably benign Het
Pot1a A G 6: 25,758,802 (GRCm39) *326Q probably null Het
Ppp5c G T 7: 16,741,071 (GRCm39) F335L probably damaging Het
Prl8a2 T C 13: 27,536,794 (GRCm39) Y139H probably benign Het
Rogdi G T 16: 4,829,601 (GRCm39) R93S probably benign Het
Rsph6a C A 7: 18,791,505 (GRCm39) R225S probably damaging Het
Septin8 T C 11: 53,428,684 (GRCm39) S408P possibly damaging Het
Sf3a2 T A 10: 80,639,131 (GRCm39) probably null Het
Shank3 T C 15: 89,433,043 (GRCm39) S1263P possibly damaging Het
Speer4f2 A C 5: 17,579,459 (GRCm39) D86A Het
Spmip8 A T 8: 96,046,686 (GRCm39) I120F probably damaging Het
Stard9 T C 2: 120,530,529 (GRCm39) F2262S possibly damaging Het
Svep1 T A 4: 58,069,378 (GRCm39) I2803F probably benign Het
Taf1c C T 8: 120,329,565 (GRCm39) probably null Het
Tasor2 G A 13: 3,624,881 (GRCm39) Q1690* probably null Het
Tfap2a C T 13: 40,872,744 (GRCm39) V317I probably benign Het
Thnsl2 T C 6: 71,106,317 (GRCm39) T370A probably benign Het
Tmem201 C T 4: 149,803,177 (GRCm39) G564S probably benign Het
Ttc41 A C 10: 86,612,030 (GRCm39) E1101A probably damaging Het
Ugcg T A 4: 59,211,974 (GRCm39) F113L possibly damaging Het
Unc80 G T 1: 66,690,692 (GRCm39) V2456L probably benign Het
Vav3 A T 3: 109,331,323 (GRCm39) N74I probably damaging Het
Vmn2r25 T A 6: 123,829,976 (GRCm39) R58S probably benign Het
Wdr97 C A 15: 76,247,819 (GRCm39) F1614L Het
Ylpm1 T A 12: 85,080,801 (GRCm39) M1499K probably benign Het
Zfp647 A G 15: 76,795,571 (GRCm39) V363A possibly damaging Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120,022,982 (GRCm39) missense probably benign 0.08
IGL00590:Abca16 APN 7 120,023,038 (GRCm39) missense probably damaging 1.00
IGL01320:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01322:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01613:Abca16 APN 7 120,140,500 (GRCm39) missense probably benign 0.03
IGL01774:Abca16 APN 7 120,021,024 (GRCm39) splice site probably benign
IGL01774:Abca16 APN 7 120,077,058 (GRCm39) missense probably damaging 1.00
IGL01797:Abca16 APN 7 120,113,760 (GRCm39) missense probably benign 0.15
IGL02406:Abca16 APN 7 120,139,825 (GRCm39) missense probably damaging 1.00
IGL02437:Abca16 APN 7 120,132,952 (GRCm39) missense probably benign 0.00
IGL02541:Abca16 APN 7 120,113,881 (GRCm39) missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120,032,678 (GRCm39) missense probably benign 0.05
IGL02578:Abca16 APN 7 120,023,179 (GRCm39) critical splice donor site probably null
IGL03156:Abca16 APN 7 120,023,074 (GRCm39) missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120,127,041 (GRCm39) missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120,139,351 (GRCm39) missense probably benign 0.31
R0024:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0123:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0134:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0225:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0346:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R0355:Abca16 UTSW 7 120,023,021 (GRCm39) missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120,143,939 (GRCm39) missense probably benign 0.01
R0525:Abca16 UTSW 7 120,065,033 (GRCm39) nonsense probably null
R0617:Abca16 UTSW 7 120,032,834 (GRCm39) splice site probably benign
R0625:Abca16 UTSW 7 120,035,116 (GRCm39) missense probably damaging 1.00
R0835:Abca16 UTSW 7 120,065,007 (GRCm39) missense probably benign 0.42
R1445:Abca16 UTSW 7 120,119,256 (GRCm39) missense probably benign 0.41
R1535:Abca16 UTSW 7 120,139,928 (GRCm39) missense probably benign 0.30
R1567:Abca16 UTSW 7 120,030,352 (GRCm39) missense probably benign 0.08
R1694:Abca16 UTSW 7 120,119,307 (GRCm39) missense probably damaging 1.00
R1860:Abca16 UTSW 7 120,133,986 (GRCm39) missense probably benign 0.02
R1876:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R1913:Abca16 UTSW 7 120,140,463 (GRCm39) missense probably benign 0.04
R1940:Abca16 UTSW 7 120,032,832 (GRCm39) splice site probably benign
R2042:Abca16 UTSW 7 120,143,941 (GRCm39) missense probably benign
R2115:Abca16 UTSW 7 120,139,868 (GRCm39) missense probably damaging 1.00
R2122:Abca16 UTSW 7 120,119,184 (GRCm39) missense probably damaging 1.00
R2265:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2267:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2269:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2993:Abca16 UTSW 7 120,134,384 (GRCm39) missense probably damaging 1.00
R3055:Abca16 UTSW 7 120,035,074 (GRCm39) missense probably benign 0.05
R3956:Abca16 UTSW 7 120,126,975 (GRCm39) missense probably damaging 0.96
R4114:Abca16 UTSW 7 120,126,290 (GRCm39) missense probably benign 0.06
R4441:Abca16 UTSW 7 120,127,024 (GRCm39) missense probably benign 0.04
R4601:Abca16 UTSW 7 120,035,920 (GRCm39) missense probably damaging 0.98
R4706:Abca16 UTSW 7 120,064,988 (GRCm39) missense probably damaging 1.00
R4807:Abca16 UTSW 7 120,139,832 (GRCm39) missense probably damaging 1.00
R4824:Abca16 UTSW 7 120,074,702 (GRCm39) missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120,126,309 (GRCm39) missense probably damaging 0.98
R5152:Abca16 UTSW 7 120,139,846 (GRCm39) missense probably benign 0.02
R5257:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5258:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5330:Abca16 UTSW 7 120,102,600 (GRCm39) missense probably benign 0.15
R5388:Abca16 UTSW 7 120,139,969 (GRCm39) critical splice donor site probably null
R5590:Abca16 UTSW 7 120,143,995 (GRCm39) missense probably damaging 0.98
R5810:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6161:Abca16 UTSW 7 120,139,934 (GRCm39) missense probably damaging 1.00
R6313:Abca16 UTSW 7 120,126,344 (GRCm39) missense probably damaging 1.00
R6485:Abca16 UTSW 7 120,026,390 (GRCm39) nonsense probably null
R6527:Abca16 UTSW 7 120,076,995 (GRCm39) missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120,126,276 (GRCm39) missense probably damaging 1.00
R6885:Abca16 UTSW 7 120,119,332 (GRCm39) missense probably benign 0.07
R6899:Abca16 UTSW 7 120,126,264 (GRCm39) missense probably damaging 1.00
R6941:Abca16 UTSW 7 120,140,370 (GRCm39) missense probably damaging 1.00
R6990:Abca16 UTSW 7 120,126,950 (GRCm39) missense probably benign 0.00
R7059:Abca16 UTSW 7 120,020,971 (GRCm39) missense probably benign 0.00
R7144:Abca16 UTSW 7 120,032,796 (GRCm39) missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120,126,974 (GRCm39) missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120,026,409 (GRCm39) missense probably damaging 1.00
R7308:Abca16 UTSW 7 120,022,993 (GRCm39) missense probably benign 0.01
R7449:Abca16 UTSW 7 120,035,131 (GRCm39) missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120,119,211 (GRCm39) missense probably benign 0.11
R7617:Abca16 UTSW 7 120,102,694 (GRCm39) nonsense probably null
R7646:Abca16 UTSW 7 120,113,937 (GRCm39) missense probably benign 0.04
R7750:Abca16 UTSW 7 120,113,928 (GRCm39) missense probably benign 0.09
R7763:Abca16 UTSW 7 120,113,825 (GRCm39) missense probably damaging 1.00
R7840:Abca16 UTSW 7 120,074,689 (GRCm39) missense probably benign 0.00
R7946:Abca16 UTSW 7 120,126,398 (GRCm39) missense probably benign 0.01
R8018:Abca16 UTSW 7 120,132,866 (GRCm39) missense probably benign 0.04
R8413:Abca16 UTSW 7 120,023,123 (GRCm39) missense probably benign 0.06
R8461:Abca16 UTSW 7 120,035,918 (GRCm39) missense possibly damaging 0.95
R8858:Abca16 UTSW 7 120,052,327 (GRCm39) missense probably benign
R8881:Abca16 UTSW 7 120,074,794 (GRCm39) missense probably benign 0.18
R9272:Abca16 UTSW 7 120,076,993 (GRCm39) missense probably benign 0.13
R9303:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9305:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9320:Abca16 UTSW 7 120,139,320 (GRCm39) missense probably damaging 0.98
R9413:Abca16 UTSW 7 120,126,422 (GRCm39) missense probably benign 0.01
R9512:Abca16 UTSW 7 120,022,963 (GRCm39) missense probably benign 0.01
R9559:Abca16 UTSW 7 120,021,019 (GRCm39) critical splice donor site probably null
R9615:Abca16 UTSW 7 120,126,404 (GRCm39) missense probably benign 0.01
R9641:Abca16 UTSW 7 120,126,308 (GRCm39) missense possibly damaging 0.52
R9643:Abca16 UTSW 7 120,065,023 (GRCm39) missense possibly damaging 0.96
R9674:Abca16 UTSW 7 120,074,668 (GRCm39) critical splice acceptor site probably null
R9714:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.01
R9799:Abca16 UTSW 7 120,132,998 (GRCm39) missense probably benign 0.00
R9800:Abca16 UTSW 7 120,119,283 (GRCm39) missense possibly damaging 0.68
RF020:Abca16 UTSW 7 120,132,880 (GRCm39) missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120,102,609 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTAGCATGTGTTGGATGATATAAG -3'
(R):5'- GAGTACTTTGGTTCAAATAGTACGG -3'

Sequencing Primer
(F):5'- GCATGTGTTGGATGATATAAGTACAG -3'
(R):5'- CCCATAGACTCATGTGTGAATGC -3'
Posted On 2020-07-13