Mutagenetix > Incidental Mutation

Incidental Mutation 'R8171:Kcnt2'

634078

Institutional Source

Beutler Lab

Gene Symbol

Kcnt2

Ensembl Gene

ENSMUSG00000052726

Gene Name

potassium channel, subfamily T, member 2

Synonyms

E330038N15Rik

MMRRC Submission

067597-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R8171 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

140246158-140612067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 140509465 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 545 (N545K)

Ref Sequence

ENSEMBL: ENSMUSP00000113333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]

AlphaFold

D3Z649

Predicted Effect

probably benign
Transcript: ENSMUST00000119786
AA Change: N495K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: N495K

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.6e-15	PFAM
Pfam:BK_channel_a	422	476	2.3e-16	PFAM
low complexity region	598	613	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	699	714	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120709
AA Change: N545K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: N545K

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.7e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC
low complexity region	749	764	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120796
AA Change: N545K

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: N545K

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193606

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	G	T	14: 32,662,025	A661E	probably benign	Het
4932438A13Rik	T	C	3: 36,975,713	V2423A	probably benign	Het
4933425L06Rik	T	A	13: 105,109,783	V284E	probably benign	Het
Abhd14a	T	A	9: 106,440,761	T142S	probably benign	Het
Actn1	A	G	12: 80,196,393		probably null	Het
Adss	T	C	1: 177,796,351	N15S	probably benign	Het
Alpk2	A	G	18: 65,305,983	S780P	probably benign	Het
Asap1	G	T	15: 64,110,966	L830M	probably damaging	Het
Atic	T	C	1: 71,569,873	V319A	possibly damaging	Het
Atp8a2	A	T	14: 60,046,044	I87N	probably damaging	Het
Bace2	G	T	16: 97,424,586	V407L	possibly damaging	Het
Bmp3	A	T	5: 98,872,669	Y317F	probably damaging	Het
Ccdc159	A	G	9: 21,933,711	E291G	possibly damaging	Het
Cct8l1	T	A	5: 25,516,554	L89Q	probably damaging	Het
Cep83	T	A	10: 94,768,935	N503K	possibly damaging	Het
Ces4a	A	G	8: 105,147,207	Y436C	probably damaging	Het
Cftr	T	A	6: 18,258,288	D579E	probably damaging	Het
Chd9	T	A	8: 91,025,387	V1751D	possibly damaging	Het
Clasp2	A	T	9: 113,903,906	T937S	possibly damaging	Het
Clock	T	A	5: 76,266,414	D17V	possibly damaging	Het
Cpm	T	C	10: 117,683,315	L376P	probably damaging	Het
Crocc2	T	C	1: 93,189,001		probably null	Het
Csnk1g2	A	G	10: 80,639,802	D401G	probably damaging	Het
Cyb5r4	C	T	9: 87,042,810	L206F	possibly damaging	Het
Cyp1a1	T	A	9: 57,700,196	W36R	probably benign	Het
Cyp3a59	A	T	5: 146,085,774	H30L	probably damaging	Het
Dab2	G	A	15: 6,423,926	V182I	probably benign	Het
Dnah1	G	T	14: 31,297,110	F1342L	probably damaging	Het
Draxin	A	T	4: 148,115,666	L109Q	possibly damaging	Het
Elfn1	G	A	5: 139,971,357	V39M	probably damaging	Het
Erlin1	A	G	19: 44,069,329	I19T	probably benign	Het
F830016B08Rik	T	A	18: 60,300,078	S78T	possibly damaging	Het
Fer1l4	A	G	2: 156,048,231	V258A	probably benign	Het
Fgb	T	C	3: 83,042,515	D445G	probably damaging	Het
Fgd6	T	C	10: 94,074,332		probably null	Het
Frem3	T	A	8: 80,615,240	D1387E	probably damaging	Het
Gdf3	T	C	6: 122,609,903	T22A	probably benign	Het
Glcci1	C	T	6: 8,593,167	A511V	probably benign	Het
Gldc	A	T	19: 30,133,761	N538K	probably benign	Het
Glipr1l1	C	T	10: 112,078,384	P217S	probably benign	Het
Gm35339	C	A	15: 76,363,619	F1614L		Het
Gpr161	A	G	1: 165,306,436	N89S	probably damaging	Het
Gypa	T	A	8: 80,509,463	S166T	probably benign	Het
Hcar1	A	G	5: 123,879,089	S180P	probably damaging	Het
Hcn1	T	C	13: 117,602,734	S11P	unknown	Het
Hectd4	A	G	5: 121,318,756	E728G	possibly damaging	Het
Ints14	A	T	9: 64,973,250	H213L	possibly damaging	Het
Itih1	A	T	14: 30,937,090	M323K	possibly damaging	Het
Ivl	A	G	3: 92,571,778	S327P	probably damaging	Het
Kdm4b	A	T	17: 56,389,534	R417W	probably damaging	Het
Kif13a	T	C	13: 46,778,968	E1083G	probably damaging	Het
Klhl40	A	T	9: 121,778,557	H261L	probably benign	Het
Kpnb1	A	G	11: 97,175,747		probably null	Het
Lamc3	C	A	2: 31,914,971	T621N	probably benign	Het
Lingo3	T	C	10: 80,834,761	H445R	probably benign	Het
Ly75	G	A	2: 60,314,228	T1297I	possibly damaging	Het
Lypd6	C	T	2: 50,190,747	T149M	possibly damaging	Het
Mcrs1	A	T	15: 99,248,732	D139E	probably damaging	Het
Muc5b	G	A	7: 141,861,000	S2561N	unknown	Het
Mybpc1	C	T	10: 88,523,003	G1095R	probably damaging	Het
Myh1	A	G	11: 67,202,572	Y163C	probably damaging	Het
Notch4	T	A	17: 34,582,509	C1110*	probably null	Het
Olfr1257	A	G	2: 89,881,065	I80V	probably benign	Het
Olfr527	A	T	7: 140,336,230	I123F	probably damaging	Het
Olfr705	C	T	7: 106,714,618	S21N	probably benign	Het
Olfr705	T	A	7: 106,714,619	S21C		Het
Pcsk1	T	A	13: 75,090,091	C10*	probably null	Het
Pdlim5	A	T	3: 142,312,187	S107T	probably benign	Het
Plac8l1	T	A	18: 42,180,380	D99V	probably damaging	Het
Plin2	A	T	4: 86,657,112	V400E	probably damaging	Het
Plxna1	G	A	6: 89,357,120	P176S	probably benign	Het
Pnn	A	G	12: 59,070,437	K238R	probably damaging	Het
Pou5f1	A	G	17: 35,510,036	E231G	probably benign	Het
Ppara	A	T	15: 85,797,876	M258L	probably benign	Het
Prune2	G	A	19: 17,120,518	D1129N	probably damaging	Het
Rai14	G	A	15: 10,633,163	T47M	probably damaging	Het
Rdh5	T	C	10: 128,918,100	I117V	probably benign	Het
Rpain	G	A	11: 70,973,898	C137Y	probably damaging	Het
Scn3a	A	G	2: 65,530,810	V126A	possibly damaging	Het
Senp7	G	T	16: 56,111,726	L129F	probably damaging	Het
Setd1a	A	G	7: 127,791,227	D1025G	unknown	Het
Sirt4	A	T	5: 115,483,023	V30E	probably damaging	Het
Slit1	C	A	19: 41,727,073	R113L	probably damaging	Het
Stxbp5l	G	A	16: 37,208,054	T549I	noncoding transcript	Het
Sytl2	A	G	7: 90,409,470	M926V	probably damaging	Het
Tgfbr2	C	T	9: 116,130,006	W113*	probably null	Het
Tmem86a	A	G	7: 47,053,764	Y213C	probably damaging	Het
Tpo	T	A	12: 30,104,046	Y220F	probably damaging	Het
Ttc6	C	A	12: 57,673,310	A889E	probably damaging	Het
Tyw1	A	G	5: 130,300,014	D547G	probably benign	Het
Ubtfl1	A	G	9: 18,409,227	K17R	probably benign	Het
Usp46	T	A	5: 74,002,693	I331F	probably benign	Het
Vmn2r111	T	C	17: 22,573,092	H61R	probably benign	Het
Wdr75	T	A	1: 45,822,546	N715K	probably benign	Het
Zfp772	A	T	7: 7,204,097	C198*	probably null	Het

Other mutations in Kcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Kcnt2	APN	1	140523098	missense	probably damaging	1.00
IGL00673:Kcnt2	APN	1	140596051	missense	possibly damaging	0.60
IGL00806:Kcnt2	APN	1	140523211	missense	probably damaging	1.00
IGL01135:Kcnt2	APN	1	140354555	critical splice donor site	probably null	0.00
IGL01412:Kcnt2	APN	1	140570417	missense	probably benign	0.02
IGL01777:Kcnt2	APN	1	140595998	missense	probably benign	0.20
IGL01780:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02134:Kcnt2	APN	1	140376383	missense	probably benign
IGL02350:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02357:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02481:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02483:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02866:Kcnt2	APN	1	140425248	missense	probably damaging	1.00
IGL02891:Kcnt2	APN	1	140574806	missense	probably damaging	1.00
IGL03007:Kcnt2	APN	1	140354507	missense	possibly damaging	0.50
IGL03024:Kcnt2	APN	1	140570455	missense	probably benign	0.00
IGL03231:Kcnt2	APN	1	140534002	intron	probably benign
BB002:Kcnt2	UTSW	1	140354509	nonsense	probably null
BB012:Kcnt2	UTSW	1	140354509	nonsense	probably null
R0230:Kcnt2	UTSW	1	140246345	missense	probably benign	0.00
R0367:Kcnt2	UTSW	1	140351225	missense	probably damaging	1.00
R0486:Kcnt2	UTSW	1	140509480	nonsense	probably null
R0543:Kcnt2	UTSW	1	140609614	missense	probably damaging	1.00
R0849:Kcnt2	UTSW	1	140507762	missense	probably damaging	1.00
R1123:Kcnt2	UTSW	1	140573608	missense	probably damaging	1.00
R1156:Kcnt2	UTSW	1	140428855	missense	probably damaging	1.00
R1425:Kcnt2	UTSW	1	140383028	missense	probably damaging	1.00
R1530:Kcnt2	UTSW	1	140484232	nonsense	probably null
R1546:Kcnt2	UTSW	1	140431378	missense	probably benign	0.01
R1728:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1729:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1730:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1739:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1762:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1783:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1784:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1785:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1862:Kcnt2	UTSW	1	140425330	missense	probably damaging	1.00
R1887:Kcnt2	UTSW	1	140584247	missense	probably damaging	0.99
R1889:Kcnt2	UTSW	1	140584293	missense	probably damaging	1.00
R1894:Kcnt2	UTSW	1	140425341	missense	probably damaging	1.00
R2005:Kcnt2	UTSW	1	140553018	missense	probably damaging	0.98
R2044:Kcnt2	UTSW	1	140375154	missense	probably benign	0.14
R2115:Kcnt2	UTSW	1	140552963	missense	probably damaging	1.00
R2135:Kcnt2	UTSW	1	140428813	missense	probably damaging	1.00
R2201:Kcnt2	UTSW	1	140509441	missense	probably damaging	1.00
R2212:Kcnt2	UTSW	1	140530800	missense	probably damaging	1.00
R2267:Kcnt2	UTSW	1	140573683	splice site	probably null
R2442:Kcnt2	UTSW	1	140376353	missense	possibly damaging	0.59
R3121:Kcnt2	UTSW	1	140428884	missense	probably damaging	0.97
R3176:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3276:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3704:Kcnt2	UTSW	1	140533968	missense	probably damaging	1.00
R3944:Kcnt2	UTSW	1	140584287	missense	probably damaging	1.00
R4164:Kcnt2	UTSW	1	140609630	missense	probably damaging	0.97
R4201:Kcnt2	UTSW	1	140425332	missense	probably damaging	0.98
R4501:Kcnt2	UTSW	1	140552980	missense	probably damaging	0.99
R4502:Kcnt2	UTSW	1	140507747	missense	probably damaging	0.99
R4632:Kcnt2	UTSW	1	140523148	missense	possibly damaging	0.90
R4758:Kcnt2	UTSW	1	140518897	missense	probably damaging	1.00
R4790:Kcnt2	UTSW	1	140354516	missense	probably damaging	0.99
R4892:Kcnt2	UTSW	1	140513025	nonsense	probably null
R4973:Kcnt2	UTSW	1	140609650	missense	probably damaging	1.00
R5154:Kcnt2	UTSW	1	140351256	missense	possibly damaging	0.94
R5296:Kcnt2	UTSW	1	140609615	missense	probably damaging	1.00
R5353:Kcnt2	UTSW	1	140426901	missense	probably damaging	1.00
R5605:Kcnt2	UTSW	1	140574743	missense	possibly damaging	0.59
R5806:Kcnt2	UTSW	1	140509496	missense	probably damaging	1.00
R5887:Kcnt2	UTSW	1	140425366	missense	probably damaging	1.00
R5917:Kcnt2	UTSW	1	140533928	missense	probably damaging	0.99
R5961:Kcnt2	UTSW	1	140507702	missense	possibly damaging	0.82
R6123:Kcnt2	UTSW	1	140362980	missense	probably damaging	1.00
R6225:Kcnt2	UTSW	1	140426923	nonsense	probably null
R6248:Kcnt2	UTSW	1	140509478	missense	probably damaging	1.00
R6351:Kcnt2	UTSW	1	140375112	missense	probably damaging	1.00
R6380:Kcnt2	UTSW	1	140509584	missense	probably damaging	1.00
R6532:Kcnt2	UTSW	1	140584106	missense	probably damaging	0.97
R6693:Kcnt2	UTSW	1	140351227	missense	probably benign	0.00
R6817:Kcnt2	UTSW	1	140246193	unclassified	probably benign
R6856:Kcnt2	UTSW	1	140596004	missense	probably damaging	1.00
R6944:Kcnt2	UTSW	1	140584065	missense	probably benign	0.00
R6971:Kcnt2	UTSW	1	140512908	missense	probably benign	0.01
R7052:Kcnt2	UTSW	1	140383047	missense	probably damaging	0.99
R7138:Kcnt2	UTSW	1	140596040	missense	possibly damaging	0.80
R7261:Kcnt2	UTSW	1	140354517	missense	possibly damaging	0.71
R7474:Kcnt2	UTSW	1	140570478	missense	possibly damaging	0.84
R7524:Kcnt2	UTSW	1	140584055	missense	probably damaging	0.99
R7541:Kcnt2	UTSW	1	140376384	missense	probably benign	0.09
R7558:Kcnt2	UTSW	1	140523190	missense	probably damaging	0.98
R7651:Kcnt2	UTSW	1	140570461	missense	probably benign	0.40
R7730:Kcnt2	UTSW	1	140518948	missense	probably benign	0.34
R7875:Kcnt2	UTSW	1	140573647	missense	probably damaging	1.00
R7883:Kcnt2	UTSW	1	140523150	missense	probably damaging	0.99
R7925:Kcnt2	UTSW	1	140354509	nonsense	probably null
R8040:Kcnt2	UTSW	1	140450217	missense	probably damaging	1.00
R8041:Kcnt2	UTSW	1	140609660	missense	probably benign
R8268:Kcnt2	UTSW	1	140523216	missense	probably damaging	0.99
R8905:Kcnt2	UTSW	1	140507729	missense	possibly damaging	0.65
R8927:Kcnt2	UTSW	1	140428797	splice site	probably null
R8988:Kcnt2	UTSW	1	140428849	missense	probably benign	0.38
R9020:Kcnt2	UTSW	1	140584311	missense	probably benign	0.23
R9109:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9167:Kcnt2	UTSW	1	140578462	missense	probably benign	0.11
R9232:Kcnt2	UTSW	1	140484193	missense	possibly damaging	0.56
R9297:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9298:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9318:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9404:Kcnt2	UTSW	1	140425369	missense	probably damaging	1.00
X0062:Kcnt2	UTSW	1	140512991	missense	possibly damaging	0.50
Z1088:Kcnt2	UTSW	1	140573646	missense	probably damaging	1.00
Z1088:Kcnt2	UTSW	1	140584158	nonsense	probably null
Z1176:Kcnt2	UTSW	1	140376361	missense	probably damaging	1.00
Z1177:Kcnt2	UTSW	1	140609648	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- GGCTCCCTAGTTCTATTATTTGATG -3'
(R):5'- AATTCCAATGAGTTTGTACTGACCC -3'

Sequencing Primer
(F):5'- TTTTGTTCTGTTTAATTAGAGTTGGC -3'
(R):5'- TACTGACCCATGCTGGCAATG -3'

Posted On

2020-07-13